LASS2/ceramide synthase 2 cDNA ORF Clone, Mouse, untagged

Cat: MG51624-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All LASS2/ceramide synthase 2 Reagents
CRO Services
Product recommended

All LASS2/ceramide synthase 2 Reagents
LASS2/ceramide synthase 2 cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1143 bp
Description
Full length Clone DNA of Mouse ceramide synthase 2.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LASS2/ceramide synthase 2 cDNA ORF Clone, Mouse, untagged Alternative Names
0610013I17Rik cDNA ORF Clone, Mouse;AI225939 cDNA ORF Clone, Mouse;Lass2 cDNA ORF Clone, Mouse;TRH3 cDNA ORF Clone, Mouse
LASS2/ceramide synthase 2 Background Information
Full Name
ceramide synthase 2

LASS2/ceramide synthase 2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
LASS2/ceramide synthase 2 cDNA ORF Clone in Cloning Vector, Rat RG87011-U
LASS2/ceramide synthase 2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG87011-ACGLN

LASS2/ceramide synthase 2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
LASS2/ceramide synthase 2 cDNA ORF Clone in Cloning Vector, Mouse MG51624-U
LASS2/ceramide synthase 2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51624-ACGLN
LASS2/ceramide synthase 2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51624-ACG
LASS2/ceramide synthase 2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51624-ANG
LASS2/ceramide synthase 2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51624-ACR
LASS2/ceramide synthase 2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51624-ANR
LASS2/ceramide synthase 2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51624-CF
LASS2/ceramide synthase 2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51624-NF
LASS2/ceramide synthase 2 cDNA ORF Clone, Mouse, C-His tag MG51624-CH
LASS2/ceramide synthase 2 cDNA ORF Clone, Mouse, N-His tag MG51624-NH
LASS2/ceramide synthase 2 cDNA ORF Clone, Mouse, C-HA tag MG51624-CY
LASS2/ceramide synthase 2 cDNA ORF Clone, Mouse, N-HA tag MG51624-NY
LASS2/ceramide synthase 2 cDNA ORF Clone, Mouse, C-Myc tag MG51624-CM
LASS2/ceramide synthase 2 cDNA ORF Clone, Mouse, N-Myc tag MG51624-NM
LASS2/ceramide synthase 2 qPCR Primer Pairs, Mouse MP201497

LASS2/ceramide synthase 2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
LASS2/ceramide synthase 2 cDNA ORF Clone in Cloning Vector, Human HG19490-U
info info
添加购物车成功! 添加购物车失败!