CEP19 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG52333-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CEP19 Reagents
CRO Services
Product recommended

All CEP19 Reagents
CEP19 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
492 bp
Description
Full length Clone DNA of Mouse centrosomal protein 19
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CEP19 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
1500031L02Rik cDNA ORF Clone, Mouse;AI428934 cDNA ORF Clone, Mouse;AL022620 cDNA ORF Clone, Mouse
CEP19 Background Information
Full Name
centrosomal protein 19kDa

CEP19 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CEP19 cDNA ORF Clone in Cloning Vector, Mouse MG52333-U
CEP19 cDNA ORF Clone, Mouse, untagged MG52333-UT
CEP19 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52333-ACGLN
CEP19 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52333-ACG
CEP19 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52333-ANG
CEP19 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52333-ACR
CEP19 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52333-ANR
CEP19 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52333-NF
CEP19 cDNA ORF Clone, Mouse, C-His tag MG52333-CH
CEP19 cDNA ORF Clone, Mouse, N-His tag MG52333-NH
CEP19 cDNA ORF Clone, Mouse, C-HA tag MG52333-CY
CEP19 cDNA ORF Clone, Mouse, N-HA tag MG52333-NY
CEP19 cDNA ORF Clone, Mouse, C-Myc tag MG52333-CM
CEP19 cDNA ORF Clone, Mouse, N-Myc tag MG52333-NM
CEP19 qPCR Primer Pairs, Mouse MP202206

CEP19 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CEP19 cDNA ORF Clone in Cloning Vector, Human HG16992-U
CEP19 cDNA ORF Clone, Human, untagged HG16992-UT
CEP19 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16992-ACGLN
CEP19 cDNA ORF Clone, Human, C-GFPSpark® tag HG16992-ACG
CEP19 cDNA ORF Clone, Human, N-GFPSpark® tag HG16992-ANG
CEP19 cDNA ORF Clone, Human, C-OFPSpark® tag HG16992-ACR
CEP19 cDNA ORF Clone, Human, N-OFPSpark® tag HG16992-ANR
CEP19 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16992-CF
CEP19 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16992-NF
CEP19 cDNA ORF Clone, Human, C-His tag HG16992-CH
CEP19 cDNA ORF Clone, Human, N-His tag HG16992-NH
CEP19 cDNA ORF Clone, Human, C-HA tag HG16992-CY
CEP19 cDNA ORF Clone, Human, N-HA tag HG16992-NY
CEP19 cDNA ORF Clone, Human, C-Myc tag HG16992-CM
CEP19 cDNA ORF Clone, Human, N-Myc tag HG16992-NM
info info
添加购物车成功! 添加购物车失败!