CDK9/CDC2L4 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG50897-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CDK9/CDC2L4 Reagents
CRO Services
Product recommended

All CDK9/CDC2L4 Reagents
CDK9/CDC2L4 cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1119 bp
Description
Full length Clone DNA of Mouse cyclin-dependent kinase 9 (CDC2-related kinase) with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CDK9/CDC2L4 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
PITALRE cDNA ORF Clone, Mouse
CDK9/CDC2L4 Background Information
Full Name
cyclin-dependent kinase 9

CDK9/CDC2L4 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CDK9/CDC2L4 cDNA ORF Clone in Cloning Vector, Mouse MG50897-G
CDK9/CDC2L4 cDNA ORF Clone, Mouse, untagged MG50897-UT
CDK9/CDC2L4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50897-ACGLN
CDK9/CDC2L4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50897-ACG
CDK9/CDC2L4 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50897-ANG
CDK9/CDC2L4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50897-ACR
CDK9/CDC2L4 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50897-ANR
CDK9/CDC2L4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50897-CF
CDK9/CDC2L4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50897-NF
CDK9/CDC2L4 cDNA ORF Clone, Mouse, C-His tag MG50897-CH
CDK9/CDC2L4 cDNA ORF Clone, Mouse, N-His tag MG50897-NH
CDK9/CDC2L4 cDNA ORF Clone, Mouse, C-HA tag MG50897-CY
CDK9/CDC2L4 cDNA ORF Clone, Mouse, N-HA tag MG50897-NY
CDK9/CDC2L4 cDNA ORF Clone, Mouse, C-Myc tag MG50897-CM
CDK9/CDC2L4 qPCR Primer Pairs, Mouse MP200868

CDK9/CDC2L4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CDK9/CDC2L4 cDNA ORF Clone in Cloning Vector, Human HG10907-G
CDK9/CDC2L4 cDNA ORF Clone, Human, untagged HG10907-UT
CDK9/CDC2L4 cDNA ORF Clone, Human, C-GFPSpark® tag HG10907-ACG
CDK9/CDC2L4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10907-ACGLN
CDK9/CDC2L4 cDNA ORF Clone, Human, N-GFPSpark® tag HG10907-ANG
CDK9/CDC2L4 cDNA ORF Clone, Human, C-OFPSpark® tag HG10907-ACR
CDK9/CDC2L4 cDNA ORF Clone, Human, N-OFPSpark® tag HG10907-ANR
CDK9/CDC2L4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10907-CF
CDK9/CDC2L4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10907-NF
CDK9/CDC2L4 cDNA ORF Clone, Human, C-His tag HG10907-CH
CDK9/CDC2L4 cDNA ORF Clone, Human, N-His tag HG10907-NH
CDK9/CDC2L4 cDNA ORF Clone, Human, C-HA tag HG10907-CY
CDK9/CDC2L4 cDNA ORF Clone, Human, N-HA tag HG10907-NY
CDK9/CDC2L4 cDNA ORF Clone, Human, C-Myc tag HG10907-CM
CDK9/CDC2L4 cDNA ORF Clone, Human, N-Myc tag HG10907-NM
CDK9/CDC2L4 qPCR Primer Pairs, Human HP100791
info info
添加购物车成功! 添加购物车失败!