CDK5RAP3 cDNA ORF Clone, Mouse, N-His tag

Cat: MG52956-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CDK5RAP3 Reagents
CRO Services
Product recommended

All CDK5RAP3 Reagents
CDK5RAP3 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1512 bp
Description
Full length Clone DNA of Mouse CDK5 regulatory subunit associated protein 3 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CDK5RAP3 cDNA ORF Clone, Mouse, N-His tag Alternative Names
1810007E24Rik cDNA ORF Clone, Mouse;BC002318 cDNA ORF Clone, Mouse;C53 cDNA ORF Clone, Mouse;C81486 cDNA ORF Clone, Mouse;HSF-27 cDNA ORF Clone, Mouse;IC53 cDNA ORF Clone, Mouse;MST016 cDNA ORF Clone, Mouse
CDK5RAP3 Background Information
Full Name
CDK5 regulatory subunit associated protein 3

CDK5RAP3 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
CDK5RAP3 cDNA ORF Clone in Cloning Vector, Rhesus CG90734-G
CDK5RAP3 cDNA ORF Clone, Rhesus, untagged CG90734-UT
CDK5RAP3 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90734-ACG
CDK5RAP3 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90734-ACGLN
CDK5RAP3 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90734-ANG
CDK5RAP3 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90734-ACR
CDK5RAP3 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90734-ANR
CDK5RAP3 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90734-CF
CDK5RAP3 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90734-NF
CDK5RAP3 cDNA ORF Clone, Rhesus, C-His tag CG90734-CH
CDK5RAP3 cDNA ORF Clone, Rhesus, N-His tag CG90734-NH
CDK5RAP3 cDNA ORF Clone, Rhesus, C-HA tag CG90734-CY
CDK5RAP3 cDNA ORF Clone, Rhesus, N-HA tag CG90734-NY
CDK5RAP3 cDNA ORF Clone, Rhesus, C-Myc tag CG90734-CM
CDK5RAP3 cDNA ORF Clone, Rhesus, N-Myc tag CG90734-NM

CDK5RAP3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CDK5RAP3 cDNA ORF Clone in Cloning Vector, Rat RG81180-U
CDK5RAP3 cDNA ORF Clone, Rat, untagged RG81180-UT
CDK5RAP3 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81180-ACG
CDK5RAP3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81180-ACGLN
CDK5RAP3 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81180-ANG
CDK5RAP3 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81180-ACR
CDK5RAP3 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81180-ANR
CDK5RAP3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81180-CF
CDK5RAP3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81180-NF
CDK5RAP3 cDNA ORF Clone, Rat, C-His tag RG81180-CH
CDK5RAP3 cDNA ORF Clone, Rat, N-His tag RG81180-NH
CDK5RAP3 cDNA ORF Clone, Rat, C-HA tag RG81180-CY
CDK5RAP3 cDNA ORF Clone, Rat, N-HA tag RG81180-NY
CDK5RAP3 cDNA ORF Clone, Rat, C-Myc tag RG81180-CM
CDK5RAP3 cDNA ORF Clone, Rat, N-Myc tag RG81180-NM
CDK5RAP3 qPCR Primer Pairs, Rat RP301136

CDK5RAP3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CDK5RAP3 cDNA ORF Clone in Cloning Vector, Mouse MG52956-G
CDK5RAP3 cDNA ORF Clone, Mouse, untagged MG52956-UT
CDK5RAP3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52956-ACG
CDK5RAP3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52956-ACGLN
CDK5RAP3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52956-ANG
CDK5RAP3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52956-ACR
CDK5RAP3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52956-ANR
CDK5RAP3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52956-CF
CDK5RAP3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52956-NF
CDK5RAP3 cDNA ORF Clone, Mouse, C-His tag MG52956-CH
CDK5RAP3 cDNA ORF Clone, Mouse, C-HA tag MG52956-CY
CDK5RAP3 cDNA ORF Clone, Mouse, N-HA tag MG52956-NY
CDK5RAP3 cDNA ORF Clone, Mouse, C-Myc tag MG52956-CM
CDK5RAP3 cDNA ORF Clone, Mouse, N-Myc tag MG52956-NM

CDK5RAP3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CDK5RAP3 cDNA ORF Clone, Human, untagged HG19540-UT
info info
添加购物车成功! 添加购物车失败!