CDC42 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG51481-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CDC42 Reagents
CRO Services
Product recommended

All CDC42 Reagents
CDC42 cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
576 bp
Description
Full length Clone DNA of Mouse cell division cycle 42 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CDC42 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
AI747189 cDNA ORF Clone, Mouse;AU018915 cDNA ORF Clone, Mouse
CDC42 Background Information
Full Name
cell division cycle 42
References
et al.
  • Shinjo K, et al. (1990) Molecular cloning of the gene for the human placental GTP-binding protein Gp (G25K): identification of this GTP-binding protein as the human homolog of the yeast cell-division-cycle protein CDC42. Proc Natl Acad Sci. 87(24):9853-7.
  • Munemitsu S, et al. (1990) Molecular cloning and expression of a G25K cDNA, the human homolog of the yeast cell cycle gene CDC42. Mol Cell Biol. 10(11):5977-82.
  • Walker S J, et al. (2000) Activation of phospholipase D1 by Cdc42 requires the Rho insert region. J Biol Chem. 275(21):15665-8.
  • Low B C, et al. (1999) Tyrosine phosphorylation of the Bcl-2-associated protein BNIP-2 by fibroblast growth factor receptor-1 prevents its binding to Cdc42GAP and Cdc42. J Biol Chem. 274(46): 33123-30.
  • Zhang B, et al. (1998) Interaction of Rac1 with GTPase-activating proteins and putative effectors. A comparison with Cdc42 and RhoA. J Biol Chem. 273(15):8776-82.
  • CDC42 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CDC42 cDNA ORF Clone in Cloning Vector, Rat RG80671-U
    CDC42 cDNA ORF Clone, Rat, untagged RG80671-UT
    CDC42 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80671-ACGLN
    CDC42 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80671-ACG
    CDC42 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80671-ACR
    CDC42 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80671-CF
    CDC42 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80671-NF
    CDC42 cDNA ORF Clone, Rat, C-His tag RG80671-CH
    CDC42 cDNA ORF Clone, Rat, N-His tag RG80671-NH
    CDC42 cDNA ORF Clone, Rat, C-HA tag RG80671-CY
    CDC42 cDNA ORF Clone, Rat, N-HA tag RG80671-NY
    CDC42 cDNA ORF Clone, Rat, C-Myc tag RG80671-CM
    CDC42 cDNA ORF Clone, Rat, N-Myc tag RG80671-NM
    CDC42 qPCR Primer Pairs, Rat RP300635

    CDC42 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CDC42 cDNA ORF Clone in Cloning Vector, Mouse MG51481-G
    CDC42 cDNA ORF Clone, Mouse, untagged MG51481-UT
    CDC42 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51481-ACG
    CDC42 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51481-ACGLN
    CDC42 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51481-ANG
    CDC42 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51481-ACR
    CDC42 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51481-ANR
    CDC42 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51481-CF
    CDC42 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51481-NF
    CDC42 cDNA ORF Clone, Mouse, C-His tag MG51481-CH
    CDC42 cDNA ORF Clone, Mouse, N-His tag MG51481-NH
    CDC42 cDNA ORF Clone, Mouse, C-HA tag MG51481-CY
    CDC42 cDNA ORF Clone, Mouse, N-HA tag MG51481-NY
    CDC42 cDNA ORF Clone, Mouse, C-Myc tag MG51481-CM
    CDC42 qPCR Primer Pairs, Mouse MP201365

    CDC42 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CDC42 cDNA ORF Clone in Cloning Vector, Human HG10062-M
    CDC42 cDNA ORF Clone, Human, untagged HG10062-UT
    CDC42 cDNA ORF Clone, Human, C-GFPSpark® tag HG10062-ACG
    CDC42 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10062-ACGLN
    CDC42 cDNA ORF Clone, Human, C-OFPSpark® tag HG10062-ACR
    CDC42 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10062-CF
    CDC42 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10062-NF
    CDC42 cDNA ORF Clone, Human, C-His tag HG10062-CH
    CDC42 cDNA ORF Clone, Human, N-His tag HG10062-NH
    CDC42 cDNA ORF Clone, Human, C-HA tag HG10062-CY
    CDC42 cDNA ORF Clone, Human, N-HA tag HG10062-NY
    CDC42 cDNA ORF Clone, Human, C-Myc tag HG10062-CM
    CDC42 cDNA ORF Clone, Human, N-Myc tag HG10062-NM
    CDC42 qPCR Primer Pairs, Human HP100851
    info info
    添加购物车成功! 添加购物车失败!