After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse CDC42 natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Mouse CDC42 cDNA Clone Product Information
NCBI RefSeq:NM_009861.3
RefSeq ORF Size:576bp
cDNA Description:Full length Clone DNA of Mus musculus cell division cycle 42.
Gene Synonym:AI747189, AU018915
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
References
et al.
  • Shinjo K, et al. (1990) Molecular cloning of the gene for the human placental GTP-binding protein Gp (G25K): identification of this GTP-binding protein as the human homolog of the yeast cell-division-cycle protein CDC42. Proc Natl Acad Sci. 87(24):9853-7.
  • Munemitsu S, et al. (1990) Molecular cloning and expression of a G25K cDNA, the human homolog of the yeast cell cycle gene CDC42. Mol Cell Biol. 10(11):5977-82.
  • Walker S J, et al. (2000) Activation of phospholipase D1 by Cdc42 requires the Rho insert region. J Biol Chem. 275(21):15665-8.
  • Low B C, et al. (1999) Tyrosine phosphorylation of the Bcl-2-associated protein BNIP-2 by fibroblast growth factor receptor-1 prevents its binding to Cdc42GAP and Cdc42. J Biol Chem. 274(46): 33123-30.
  • Zhang B, et al. (1998) Interaction of Rac1 with GTPase-activating proteins and putative effectors. A comparison with Cdc42 and RhoA. J Biol Chem. 273(15):8776-82.
  • Size / Price
    Catalog: MG51481-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability
     Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"