CDC37 cDNA ORF Clone, Mouse, N-His tag

Cat: MG50826-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CDC37 Reagents
CRO Services
Product recommended

All CDC37 Reagents
CDC37 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1140 bp
Description
Full length Clone DNA of Mouse cell division cycle 37 homolog (S. cerevisiae) with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CDC37 cDNA ORF Clone, Mouse, N-His tag Alternative Names
p50 cDNA ORF Clone, Mouse;p50Cdc37 cDNA ORF Clone, Mouse
CDC37 Background Information

CDC37 is a protein that is expressed in proliferative zones during embryonic development and in adult tissues, consistent with a positive role in proliferation and is required for cell division in budding yeast. CDC37 is though to play an important role in the establishment of signaling pathways controlling cell proliferation through targeting intrinsically unstable oncoprotein kinases such as Cdk-4, Raf-1, and src to the molecular chaperone Hsp90. Decreased Hsp90 expression can reduce the levels of microtubule-associated protein tau, whose overexpression may induce many diseases. CDC37 is considered as a co-chaperone that is classified to Hsp90's accessory proteins. It has been reported that suppression of Cdc37 destabilized tau, leading to its clearance, whereas cdc37 overexpression preserved tau.Cdc37 was found to co-localize with tau in neuronal cells and to physically interact with tau from human brain. Moreover, Cdc37 levels significantly increased with age.

Full Name
cell division cycle 37
References
  • Dai K, et al. (1996) P hysical Interaction of Mammalian CDC37 with CDK4. The journal of biological chemistry. 271: 22030-4.
  • Pearl LH, et al. (2005) Hsp90 and Cdc37-a chaperone cancer conspiracy. Current opinion in genetics development. 15 (1): 55-61.
  • Chen GQ, et al. (2002) TNF-Induced Recruitment and Activation of the IKK Complex Require Cdc37 and Hsp90. Molecular cell. 9 (2): 401-10.
  • CDC37 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CDC37 cDNA ORF Clone in Cloning Vector, Mouse MG50826-G
    CDC37 cDNA ORF Clone, Mouse, untagged MG50826-UT
    CDC37 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50826-ACG
    CDC37 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50826-ACGLN
    CDC37 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50826-ANG
    CDC37 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50826-ACR
    CDC37 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50826-ANR
    CDC37 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50826-CF
    CDC37 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50826-NF
    CDC37 cDNA ORF Clone, Mouse, C-His tag MG50826-CH
    CDC37 cDNA ORF Clone, Mouse, C-HA tag MG50826-CY
    CDC37 cDNA ORF Clone, Mouse, N-HA tag MG50826-NY
    CDC37 cDNA ORF Clone, Mouse, C-Myc tag MG50826-CM
    CDC37 cDNA ORF Clone, Mouse, N-Myc tag MG50826-NM
    CDC37 qPCR Primer Pairs, Mouse MP200797

    CDC37 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CDC37 cDNA ORF Clone in Cloning Vector, Human HG10647-M
    CDC37 cDNA ORF Clone, Human, untagged HG10647-UT
    CDC37 cDNA ORF Clone, Human, C-GFPSpark® tag HG10647-ACG
    CDC37 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10647-ACGLN
    CDC37 cDNA ORF Clone, Human, N-GFPSpark® tag HG10647-ANG
    CDC37 cDNA ORF Clone, Human, C-OFPSpark® tag HG10647-ACR
    CDC37 cDNA ORF Clone, Human, N-OFPSpark® tag HG10647-ANR
    CDC37 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10647-CF
    CDC37 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10647-NF
    CDC37 cDNA ORF Clone, Human, C-His tag HG10647-CH
    CDC37 cDNA ORF Clone, Human, N-His tag HG10647-NH
    CDC37 cDNA ORF Clone, Human, C-HA tag HG10647-CY
    CDC37 cDNA ORF Clone, Human, N-HA tag HG10647-NY
    CDC37 cDNA ORF Clone, Human, C-Myc tag HG10647-CM
    CDC37 cDNA ORF Clone, Human, N-Myc tag HG10647-NM
    CDC37 qPCR Primer Pairs, Human HP100619
    info info
    添加购物车成功! 添加购物车失败!