CDK1 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG50892-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CDK1 Reagents
CRO Services
Product recommended

All CDK1 Reagents
CDK1 cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
894 bp
Description
Full length Clone DNA of Mouse cyclin-dependent kinase 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CDK1 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
Cdc2 cDNA ORF Clone, Mouse;CDC2&gt cDNA ORF Clone, Mouse;Cdc2a cDNA ORF Clone, Mouse;p34&lt cDNA ORF Clone, Mouse
CDK1 Background Information

CDC2, also known as CDK1, contains 1 protein kinase domain and belongs to the protein kinase superfamily, CMGC Ser/Thr protein kinase family, CDC2/CDKX subfamily. CDC2 is a catalytic subunit of the highly conserved protein kinase complex known as M-phase promoting factor (MPF), which is essential for G1/S and G2/M phase transitions of eukaryotic cell cycle. Mitotic cyclins stably associate with CDC2 and function as regulatory subunits. The kinase activity of CDK1 is controlled by cyclin accumulation and destruction through the cell cycle. The phosphorylation and dephosphorylation of CDC2 also play important regulatory roles in cell cycle control. It is required in higher cells for entry into S-phase and mitosis. CDC2 also is a cyclin-dependent kinase which displays CTD kinase activity and is required for RNA splicing. It has CTD kinase activity by hyperphosphorylating the C-terminal heptapeptide repeat domain (CTD) of the largest RNA polymerase II subunit RPB1, thereby acting as a key regulator of transcription elongation. CDK1 is required for RNA splicing, possibly by phosphorylating SRSF1/SF2. It is involved in regulation of MAP kinase activity, possibly leading to affect the response to estrogn inhibitors.

Full Name
cyclin-dependent kinase 1
References
  • Lee MG, et al. (1987) Complementation used to clone a human homologue of the fission yeast cell cycle control gene cdc2. Nature. 327(6117):31-5.
  • Enserink JM, et al. (2010) An overview of Cdk1-controlled targets and processes. Cell Division. 5(11): 1-41.
  • Ninomiya-Tsuji J, et al. (1991) Cloning of a human cDNA encoding a CDC2-related kinase by complementation of a budding yeast cdc28 mutation. Proc Natl Acad Sci. 88(20):9006-10.
  • Zhan Q, et al. (1999) Association with Cdc2 and inhibition of Cdc2/Cyclin B1 kinase activity by the p53-regulated protein Gadd45. Oncogene. 18(18):2892-900.
  • Jin S, et al. (2000) The GADD45 inhibition of Cdc2 kinase correlates with GADD45-mediated growth suppression. J Biol Chem. 275(22):16602-8.
  • CDK1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CDK1 cDNA ORF Clone in Cloning Vector, Mouse MG50892-G
    CDK1 cDNA ORF Clone, Mouse, untagged MG50892-UT
    CDK1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50892-ACGLN
    CDK1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50892-ACG
    CDK1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50892-ANG
    CDK1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50892-ACR
    CDK1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50892-ANR
    CDK1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50892-CF
    CDK1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50892-NF
    CDK1 cDNA ORF Clone, Mouse, C-His tag MG50892-CH
    CDK1 cDNA ORF Clone, Mouse, N-His tag MG50892-NH
    CDK1 cDNA ORF Clone, Mouse, C-HA tag MG50892-CY
    CDK1 cDNA ORF Clone, Mouse, N-HA tag MG50892-NY
    CDK1 cDNA ORF Clone, Mouse, C-Myc tag MG50892-CM
    CDK1 qPCR Primer Pairs, Mouse MP200863

    CDK1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CDK1 cDNA ORF Clone in Cloning Vector, Human HG10739-M
    CDK1 cDNA ORF Clone, Human, untagged HG10739-UT
    CDK1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10739-ACGLN
    CDK1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10739-ACG
    CDK1 cDNA ORF Clone, Human, N-GFPSpark® tag HG10739-ANG
    CDK1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10739-ACR
    CDK1 cDNA ORF Clone, Human, N-OFPSpark® tag HG10739-ANR
    CDK1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10739-CF
    CDK1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10739-NF
    CDK1 cDNA ORF Clone, Human, C-His tag HG10739-CH
    CDK1 cDNA ORF Clone, Human, N-His tag HG10739-NH
    CDK1 cDNA ORF Clone, Human, C-HA tag HG10739-CY
    CDK1 cDNA ORF Clone, Human, N-HA tag HG10739-NY
    CDK1 cDNA ORF Clone, Human, C-Myc tag HG10739-CM
    CDK1 cDNA ORF Clone, Human, N-Myc tag HG10739-NM
    CDK1 qPCR Primer Pairs, Human HP100893
    info info
    添加购物车成功! 添加购物车失败!