CD99 cDNA ORF Clone, Mouse, C-His tag

Cat: MG50520-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CD99 Reagents
CRO Services
Product recommended

All CD99 Reagents
CD99 cDNA ORF Clone, Mouse, C-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
528 bp
Description
Full length Clone DNA of Mouse CD99 antigen with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD99 cDNA ORF Clone, Mouse, C-His tag Alternative Names
1110061M03Rik cDNA ORF Clone, Mouse;2410026K10Rik cDNA ORF Clone, Mouse;D4 cDNA ORF Clone, Mouse;pilr-1 cDNA ORF Clone, Mouse;Pilr-l cDNA ORF Clone, Mouse
CD99 Background Information

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD99 is a transmembrane protein expressed on most hematopoietic cells, endothelial cells and at the borders between confluent cells. CD99 is also found expressed in the development of normal ovary and testis as well as in 25 sex cord-stromal tumors, 7 epithelial neoplasms, and 6 germ cell tumors. CD99 may be a useful marker for sex cord-stromal tumors and that its degree of reactivity correlates with the degree of differentiation in Sertoli-Leydig cell tumors. Additionally, CD99 might aid in distinguishing granulose cell tumors of the ovary from poorly differentiated carcinomas and it has been reported to be a sensitive and specific marker for Ewing's sarcoma and primitive neuroectodermal tumor.

Full Name
CD99 molecule
References
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Schenkel AR, et al. (2002) CD99 plays a major role in the migration of monocytes through endothelial junctions. Nature Immunology. 3: 143 - 50.
  • Gordon MD, et al. (1998) CD99, keratin, and vimentin staining of sex cord-stromal tumors, normal ovary, and testis. Mod Pathol. 11 (8): 769-73.
  • CD99 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CD99 cDNA ORF Clone in Cloning Vector, Rat RG80325-G
    CD99 cDNA ORF Clone, Rat, untagged RG80325-UT
    CD99 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80325-ACGLN
    CD99 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80325-ACG
    CD99 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80325-ACR
    CD99 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80325-CF
    CD99 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80325-NF
    CD99 cDNA ORF Clone, Rat, C-His tag RG80325-CH
    CD99 cDNA ORF Clone, Rat, N-His tag RG80325-NH
    CD99 cDNA ORF Clone, Rat, C-HA tag RG80325-CY
    CD99 cDNA ORF Clone, Rat, N-HA tag RG80325-NY
    CD99 cDNA ORF Clone, Rat, C-Myc tag RG80325-CM
    CD99 cDNA ORF Clone, Rat, N-Myc tag RG80325-NM
    CD99 qPCR Primer Pairs, Rat RP300296

    CD99 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CD99 cDNA ORF Clone in Cloning Vector, Mouse MG50520-M
    CD99 cDNA ORF Clone, Mouse, untagged MG50520-UT
    CD99 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50520-ACGLN
    CD99 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50520-ACG
    CD99 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50520-ACR
    CD99 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50520-CF
    CD99 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50520-NF
    CD99 cDNA ORF Clone, Mouse, N-His tag MG50520-NH
    CD99 cDNA ORF Clone, Mouse, C-HA tag MG50520-CY
    CD99 cDNA ORF Clone, Mouse, N-HA tag MG50520-NY
    CD99 cDNA ORF Clone, Mouse, C-Myc tag MG50520-CM
    CD99 cDNA ORF Clone, Mouse, N-Myc tag MG50520-NM
    CD99 qPCR Primer Pairs, Mouse MP200512

    CD99 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CD99 cDNA ORF Clone in Cloning Vector, Human HG12193-G
    CD99 cDNA ORF Clone, Human, untagged HG12193-UT
    CD99 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12193-ACGLN
    CD99 cDNA ORF Clone, Human, C-GFPSpark® tag HG12193-ACG
    CD99 cDNA ORF Clone, Human, C-OFPSpark® tag HG12193-ACR
    CD99 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12193-CF
    CD99 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12193-NF
    CD99 cDNA ORF Clone, Human, C-His tag HG12193-CH
    CD99 cDNA ORF Clone, Human, N-His tag HG12193-NH
    CD99 cDNA ORF Clone, Human, C-HA tag HG12193-CY
    CD99 cDNA ORF Clone, Human, N-HA tag HG12193-NY
    CD99 cDNA ORF Clone, Human, C-Myc tag HG12193-CM
    CD99 cDNA ORF Clone, Human, N-Myc tag HG12193-NM
    CD99 qPCR Primer Pairs, Human HP101823
    info info
    添加购物车成功! 添加购物车失败!