Quick Order

Mouse CD97 Gene ORF cDNA clone expression plasmid, N-His tag

    DatasheetReviewsRelated ProductsProtocols
    Mouse CD97 cDNA Clone Product Information
    NCBI RefSeq:AF146344.1
    RefSeq ORF Size:2175bp
    cDNA Description:Full length Clone DNA of Mus musculus adhesion G protein-coupled receptor E5 with N terminal His tag.
    Gene Synonym:TM7LN1, AA409984, Cd97
    Species:Mouse
    Vector:pCMV3-SP-N-His
    Plasmid:
    Restriction Site:
    Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Product nameProduct name
    Background

    The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. The CD97 is a receptor predominantly expressed in leukocytes and belongs to a new group of seven-span transmembrane molecules, which is also designed EGF-TM7 family. The family members are characterized by an extended extracellular region with several N-terminal epidermal growth factor-like domains two of which contain a calcium binding site. Muture CD 97 has two noncovalently associated subunits and is composed of a large extracellular protein (CD97 alpha) and a seven-membrane spanning protein (CD97 beta). CD97 is considered as a defining feature of G protein-coupled receptors. The effects that lymphocytes and erythrocytes adere to CD97-transfected COS cells suggest that CD97 has the ability to bind cellular ligands. CD97 alpha has three alternatively spliced isforms that are related to the calium binding EGF-like repeats in the microfibril protein fibrillin. Leukocytes strongly positive for CD97 are concentrated at sites of inflammation relative to CD97 expression in normal lymphoid tissues.

    References
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Gray JX, et al. (1996) CD97 is a processed, seven-transmembrane, heterodimeric receptor associated with inflammation. The journal of Immunology. 157 (12): 5438-47.
  • Hamann J,et al. (1998) Characterization of the CD55 (DAF)-binding site on the seven-span transmembrane receptor CD97.European Journal of Immunology. 28 (5): 1701-7.
  • Size / Price
    Catalog: MG50751-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"