CD8 beta cDNA ORF Clone, Mouse, C-HA tag

Cat: MG50646-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CD8 beta Reagents
CRO Services
Product recommended

All CD8 beta Reagents
CD8 beta cDNA ORF Clone, Mouse, C-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
642 bp
Description
Full length Clone DNA of Mouse CD8 antigen, beta chain 1 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD8 beta Background Information

CD8B (CD8b molecule), also known as P37 and LEU2, contains 1 Ig-like V-type (immunoglobulin-like) domain. The CD8 antigen is a cell surface glycoprotein found on most cytotoxic T lymphocytes that mediates efficient cell-cell interactions within the immune system. The CD8 antigen, acting as a coreceptor, and the T-cell receptor on the T lymphocyte recognize antigens displayed by an antigen presenting cell (APC) in the context of class I MHC molecules. The functional coreceptor is either a homodimer composed of two alpha chains, or a heterodimer composed of one alpha and one beta chain. Both alpha and beta chains share significant homology to immunoglobulin variable light chains. P37 gene encodes the CD8 beta chain isoforms. Multiple alternatively spliced transcript variants encoding distinct membrane associated or secreted isoforms have been described. A pseudogene, also located on chromosome 2, has been identified. CD8 is thought to play a role in the process of T-cell mediated killing.

Full Name
CD8b molecule
References
  • Leahy DJ, et al. (1992) Crystal structure of a soluble form of the human T cell coreceptor CD8 at 2.6 A resolution. Cell. 68(6):1145-62.
  • Gao G, et al. (2000) Molecular interactions of coreceptor CD8 and MHC class I: the molecular basis for functional coordination with the T-cell receptor. Immunol Today. 21(12):630-6.
  • Devine L, et al. (1999) Orientation of the Ig domains of CD8 alpha beta relative to MHC class I. J Immunol. 162(2):846-51.
  • CD8 beta cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    CD8 beta cDNA ORF Clone in Cloning Vector, Rhesus CG90178-G
    CD8 beta cDNA ORF Clone, Rhesus, untagged CG90178-UT
    CD8 beta Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90178-ACGLN
    CD8 beta cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90178-ACG
    CD8 beta cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90178-ACR
    CD8 beta cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90178-CF
    CD8 beta cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90178-NF
    CD8 beta cDNA ORF Clone, Rhesus, C-His tag CG90178-CH
    CD8 beta cDNA ORF Clone, Rhesus, N-His tag CG90178-NH
    CD8 beta cDNA ORF Clone, Rhesus, C-HA tag CG90178-CY
    CD8 beta cDNA ORF Clone, Rhesus, N-HA tag CG90178-NY
    CD8 beta cDNA ORF Clone, Rhesus, C-Myc tag CG90178-CM
    CD8 beta cDNA ORF Clone, Rhesus, N-Myc tag CG90178-NM

    CD8 beta cDNA ORF Clone, Cynomolgus, Related Products

    Product Name Catalog#(PDF)
    CD8 beta cDNA ORF Clone, Cynomolgus, untagged CG90887-UT

    CD8 beta cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CD8 beta cDNA ORF Clone in Cloning Vector, Mouse MG50646-M
    CD8 beta cDNA ORF Clone, Mouse, untagged MG50646-UT
    CD8 beta Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50646-ACGLN
    CD8 beta cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50646-ACG
    CD8 beta cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50646-ACR
    CD8 beta cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50646-CF
    CD8 beta cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50646-NF
    CD8 beta cDNA ORF Clone, Mouse, C-His tag MG50646-CH
    CD8 beta cDNA ORF Clone, Mouse, N-His tag MG50646-NH
    CD8 beta cDNA ORF Clone, Mouse, N-HA tag MG50646-NY
    CD8 beta cDNA ORF Clone, Mouse, C-Myc tag MG50646-CM
    CD8 beta cDNA ORF Clone, Mouse, N-Myc tag MG50646-NM
    CD8 beta qPCR Primer Pairs, Mouse MP200625

    CD8 beta cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CD8 beta cDNA ORF Clone in Cloning Vector, Human HG11031-M
    CD8 beta cDNA ORF Clone, Human, untagged HG11031-UT
    CD8 beta Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11031-ACGLN
    CD8 beta cDNA ORF Clone, Human, C-GFPSpark® tag HG11031-ACG
    CD8 beta cDNA ORF Clone, Human, C-OFPSpark® tag HG11031-ACR
    CD8 beta cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11031-CF
    CD8 beta cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11031-NF
    CD8 beta cDNA ORF Clone, Human, C-His tag HG11031-CH
    CD8 beta cDNA ORF Clone, Human, N-His tag HG11031-NH
    CD8 beta cDNA ORF Clone, Human, C-HA tag HG11031-CY
    CD8 beta cDNA ORF Clone, Human, N-HA tag HG11031-NY
    CD8 beta cDNA ORF Clone, Human, C-Myc tag HG11031-CM
    CD8 beta cDNA ORF Clone, Human, N-Myc tag HG11031-NM
    CD8 beta qPCR Primer Pairs, Human HP100989
    info info
    添加购物车成功! 添加购物车失败!