NCBI RefSeq: | NM_001042580.1 |
RefSeq ORF Size: | 717bp |
cDNA Description: | Full length Clone DNA of Mus musculus CD63 antigen. |
Gene Synonym: | ME491, C75951, Tspan30, MGC103180, MGC107286, Cd63 |
Species: | Mouse |
Vector: | pCMV3-untagged |
Plasmid: | pCMV3-mCD63 |
Restriction Site: | KpnI + XbaI (6.1kb + 0.72kb) |
Tag Sequence: | |
Sequence Description: | Identical with the Gene Bank Ref. ID sequence. |
Sequencing primers: | T7(TAATACGACTCACTATAGGG)
BGH(TAGAAGGCACAGTCGAGG) ( We provide with CD63 qPCR primers for gene expression analysis, MP200549 ) |
Promoter: | Enhanced CMV mammalian cell promoter |
Application: | Stable or Transient mammalian expression |
Antibiotic in E.coli: | Ampicillin |
Antibiotic in mammalian cell: | Hygromycin |
Shipping_carrier: | Each tube contains lyophilized plasmid. |
Storage: | The lyophilized plasmid can be stored at room temperature for three months. |