CD55 / DAF cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG50468-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CD55 / DAF Reagents
CRO Services
Product recommended

All CD55 / DAF Reagents
CD55 / DAF cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1173 bp
Description
Full length Clone DNA of Mouse CD55 antigen with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD55 / DAF cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Alternative Names
Daf cDNA ORF Clone, Mouse;Daf-GPI cDNA ORF Clone, Mouse;Daf1 cDNA ORF Clone, Mouse;GPI-DAF cDNA ORF Clone, Mouse
CD55 / DAF Background Information

CD55, also well known as decay-accelerating factor (DAF), is a member of the RCA (regulators of complement activation) family characterized by four to 30 SCRs (short consensus repeats) in their plasma-exposed regions. It is a major regulator of the alternative and classical pathways of complement activation and is expressed on all serum-exposed cells. CD55 is physiologically acting as an inhibitor of the complement system, but is also broadly expressed in malignant tumours. DAF seems to exert different functions beyond its immunological role such as promotion of tumorigenesis, decrease of complement mediated tumor cell lysis, autocrine loops for cell rescue and evasion of apoptosis, neoangiogenesis, invasiveness, cell motility. It is commonly hijacked by invading pathogens, including many enteroviruses and uropathogenic Escherichia coli, to promote cellular attachment prior to infection. This 70-75 kDa glycoprotein CD55 containing four SCR modules is involved in the regulation of the complement cascade. It inhibits complement activation by suppressing the function of C3/C5 convertases, thereby limiting local generation or deposition of C3a/C5a and membrane attack complex (MAC or C5b-9) production. DAF has been identified as a ligand for an activation-associated, seven-transmembrane lymphocyte receptor, CD97, which is a receptor mediating attachment and infection of several viruses and bacteria. In addition, it has been shown that DAF regulates the interplay between complement and T cell immunity in vivo, and thus may be implicated in immune and tumor biology.

Full Name
CD55 molecule, decay accelerating factor for complement (Cromer blood group)
References
  • Lea S. (2002) Interactions of CD55 with non-complement ligands. Biochem Soc Trans. 30(Pt 6): 1014-9.
  • Mikesch JH, et al. (2006) The expression and action of decay-accelerating factor (CD55) in human malignancies and cancer therapy. Cell Oncol. 28(5-6): 223-32.
  • Wang Y, et al. (2010) Decay accelerating factor (CD55) protects neuronal cells from chemical hypoxia-induced injury. J Neuroinflammation. 7:24.
  • CD55 / DAF cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CD55 / DAF cDNA ORF Clone in Cloning Vector, Rat RG80317-G
    CD55 / DAF cDNA ORF Clone, Rat, untagged RG80317-UT
    CD55 / DAF Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80317-ACGLN
    CD55 / DAF cDNA ORF Clone, Rat, C-GFPSpark® tag RG80317-ACG
    CD55 / DAF cDNA ORF Clone, Rat, C-OFPSpark® tag RG80317-ACR
    CD55 / DAF cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80317-CF
    CD55 / DAF cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80317-NF
    CD55 / DAF cDNA ORF Clone, Rat, C-His tag RG80317-CH
    CD55 / DAF cDNA ORF Clone, Rat, N-His tag RG80317-NH
    CD55 / DAF cDNA ORF Clone, Rat, C-HA tag RG80317-CY
    CD55 / DAF cDNA ORF Clone, Rat, N-HA tag RG80317-NY
    CD55 / DAF cDNA ORF Clone, Rat, C-Myc tag RG80317-CM
    CD55 / DAF cDNA ORF Clone, Rat, N-Myc tag RG80317-NM
    CD55 / DAF qPCR Primer Pairs, Rat RP300290

    CD55 / DAF cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CD55 / DAF cDNA ORF Clone in Cloning Vector, Mouse MG50468-M
    CD55 / DAF cDNA ORF Clone, Mouse, untagged MG50468-UT
    CD55 / DAF Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50468-ACGLN
    CD55 / DAF cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50468-ACG
    CD55 / DAF cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50468-ACR
    CD55 / DAF cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50468-CF
    CD55 / DAF cDNA ORF Clone, Mouse, C-His tag MG50468-CH
    CD55 / DAF cDNA ORF Clone, Mouse, N-His tag MG50468-NH
    CD55 / DAF cDNA ORF Clone, Mouse, C-HA tag MG50468-CY
    CD55 / DAF cDNA ORF Clone, Mouse, N-HA tag MG50468-NY
    CD55 / DAF cDNA ORF Clone, Mouse, C-Myc tag MG50468-CM
    CD55 / DAF cDNA ORF Clone, Mouse, N-Myc tag MG50468-NM
    CD55 / DAF qPCR Primer Pairs, Mouse MP200874

    CD55 / DAF cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CD55 / DAF cDNA ORF Clone in Cloning Vector, Human HG10101-M
    CD55 / DAF cDNA ORF Clone, Human, untagged HG10101-UT
    CD55 / DAF Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10101-ACGLN
    CD55 / DAF cDNA ORF Clone, Human, C-GFPSpark® tag HG10101-ACG
    CD55 / DAF cDNA ORF Clone, Human, C-OFPSpark® tag HG10101-ACR
    CD55 / DAF cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10101-CF
    CD55 / DAF cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10101-NF
    CD55 / DAF cDNA ORF Clone, Human, C-His tag HG10101-CH
    CD55 / DAF cDNA ORF Clone, Human, N-His tag HG10101-NH
    CD55 / DAF cDNA ORF Clone, Human, C-HA tag HG10101-CY
    CD55 / DAF cDNA ORF Clone, Human, N-HA tag HG10101-NY
    CD55 / DAF cDNA ORF Clone, Human, C-Myc tag HG10101-CM
    CD55 / DAF cDNA ORF Clone, Human, N-Myc tag HG10101-NM
    CD55 / DAF qPCR Primer Pairs, Human HP100103
    info info
    添加购物车成功! 添加购物车失败!