ICAM-1 cDNA ORF Clone, Mouse, untagged

Cat: MG50440-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ICAM-1 Reagents
CRO Services
Product recommended

All ICAM-1 Reagents
ICAM-1 cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1614 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse intercellular adhesion molecule 1.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Restriction Sites
KpnI + XbaI (6.1kb + 1.61kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
ICAM-1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ICAM-1 cDNA ORF Clone, Mouse, untagged Alternative Names
CD54 cDNA ORF Clone, Mouse;Icam-1 cDNA ORF Clone, Mouse;Ly-47 cDNA ORF Clone, Mouse;MALA-2 cDNA ORF Clone, Mouse
ICAM-1 Background Information

Intercellular adhesion molecule-1 (ICAM-1, or CD54) is a 90 kDa member of the immunoglobulin (Ig) superfamily and is critical for the firm arrest and transmigration of leukocytes out of blood vessels and into tissues. ICAM-1 is constitutively present on endothelial cells, but its expression is increased by proinflammatory cytokines. The endothelial expression of ICAM-1 is increased in atherosclerotic and transplant-associated atherosclerotic tissue and in animal models of atherosclerosis. Additionally, ICAM-1 has been implicated in the progression of autoimmune diseases. ICAM-1 is a ligand for LFA-1(integrin). When activated, leukocytes bind to endothelial cells via ICAM-1/LFA-1 interaction and then transmigrate into tissues. Presence with heavy glycosylation and other structural characteristics, ICAM-1 possesses binding sites for a number of immune-associated ligands and serves as the binding site for entry of the major group of human Rhinovirus (HRV) into various cell types. ICAM-1 also becomes known for its affinity for Plasmodium falciparum-infected erythrocytes (PFIE), providing more of a role in infectious disease. Previous studies have shown that ICAM-1 is involved in inflammatory reactions and that a defect in ICAM-1 gene inhibits allergic contact hypersensitivity.

Full Name
intercellular adhesion molecule 1
Research Areas
References
  • Xu H, et al. (2001) The role of ICAM-1 molecule in the migration of Langerhans cells in the skin and regional lymph node. Eur J Immunol. 31(10): 3085-93.
  • Terol MJ, et al. (2003) Soluble intercellular adhesion molecule-1 (s-ICAM-1/s-CD54) in diffuse large B-cell lymphoma: association with clinical characteristics and outcome. Ann Oncol. 14(3): 467-74.
  • Mendez MP, et al. (2006) Shedding of soluble ICAM-1 into the alveolar space in murine models of acute lung injury. Am J Physiol Lung Cell Mol Physiol. 290(5): L962-70.
  • Lawson C, et al. (2009) ICAM-1 signaling in endothelial cells. Pharmacol Rep. 61(1): 22-32.
  • ICAM-1 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    ICAM-1 cDNA ORF Clone in Cloning Vector, Rhesus CG90320-G
    ICAM-1 cDNA ORF Clone, Rhesus, untagged CG90320-UT
    ICAM-1 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90320-ACGLN
    ICAM-1 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90320-ACG
    ICAM-1 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90320-ACR
    ICAM-1 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90320-CF
    ICAM-1 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90320-NF
    ICAM-1 cDNA ORF Clone, Rhesus, C-His tag CG90320-CH
    ICAM-1 cDNA ORF Clone, Rhesus, N-His tag CG90320-NH
    ICAM-1 cDNA ORF Clone, Rhesus, C-HA tag CG90320-CY
    ICAM-1 cDNA ORF Clone, Rhesus, N-HA tag CG90320-NY
    ICAM-1 cDNA ORF Clone, Rhesus, C-Myc tag CG90320-CM
    ICAM-1 cDNA ORF Clone, Rhesus, N-Myc tag CG90320-NM

    ICAM-1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    ICAM-1 cDNA ORF Clone in Cloning Vector, Rat RG80022-M
    ICAM-1 cDNA ORF Clone, Rat, untagged RG80022-UT
    ICAM-1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80022-ACGLN
    ICAM-1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80022-ACG
    ICAM-1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80022-ACR
    ICAM-1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80022-CF
    ICAM-1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80022-NF
    ICAM-1 cDNA ORF Clone, Rat, C-His tag RG80022-CH
    ICAM-1 cDNA ORF Clone, Rat, N-His tag RG80022-NH
    ICAM-1 cDNA ORF Clone, Rat, C-HA tag RG80022-CY
    ICAM-1 cDNA ORF Clone, Rat, N-HA tag RG80022-NY
    ICAM-1 cDNA ORF Clone, Rat, C-Myc tag RG80022-CM
    ICAM-1 cDNA ORF Clone, Rat, N-Myc tag RG80022-NM
    ICAM-1 qPCR Primer Pairs, Rat RP300021

    ICAM-1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    ICAM-1 cDNA ORF Clone in Cloning Vector, Mouse MG50440-M
    ICAM-1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50440-ACG
    ICAM-1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50440-ACGLN
    ICAM-1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50440-ACR
    ICAM-1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50440-CF
    ICAM-1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50440-NF
    ICAM-1 cDNA ORF Clone, Mouse, C-His tag MG50440-CH
    ICAM-1 cDNA ORF Clone, Mouse, N-His tag MG50440-NH
    ICAM-1 cDNA ORF Clone, Mouse, C-HA tag MG50440-CY
    ICAM-1 cDNA ORF Clone, Mouse, N-HA tag MG50440-NY
    ICAM-1 cDNA ORF Clone, Mouse, C-Myc tag MG50440-CM
    ICAM-1 cDNA ORF Clone, Mouse, N-Myc tag MG50440-NM
    ICAM-1 qPCR Primer Pairs, Mouse MP200449

    ICAM-1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    ICAM-1 cDNA ORF Clone in Cloning Vector, Human HG10346-M
    ICAM-1 cDNA ORF Clone, Human, untagged HG10346-UT
    ICAM-1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10346-ACGLN
    ICAM-1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10346-ACG
    ICAM-1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10346-ACR
    ICAM-1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10346-CF
    ICAM-1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10346-NF
    ICAM-1 cDNA ORF Clone, Human, C-His tag HG10346-CH
    ICAM-1 cDNA ORF Clone, Human, N-His tag HG10346-NH
    ICAM-1 cDNA ORF Clone, Human, C-HA tag HG10346-CY
    ICAM-1 cDNA ORF Clone, Human, N-HA tag HG10346-NY
    ICAM-1 cDNA ORF Clone, Human, C-Myc tag HG10346-CM
    ICAM-1 cDNA ORF Clone, Human, N-Myc tag HG10346-NM
    ICAM-1 qPCR Primer Pairs, Human HP100384
    info info
    添加购物车成功! 添加购物车失败!