Quick Order

Text Size:AAA

Mouse ICAM-1/CD54 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Mouse ICAM1 cDNA Clone Product Information
NCBI RefSeq:NM_010493.2
RefSeq ORF Size:1614bp
cDNA Description:Full length Clone DNA of Mus musculus intercellular adhesion molecule 1.
Gene Synonym:CD54, Ly-47, Icam-1, MALA-2, MGC6195, Icam1
Species:Mouse
Vector:pCMV3-untagged
Plasmid:pCMV3-mICAM1
Restriction Site:KpnI + XbaI (6.1kb + 1.61kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Intercellular adhesion molecule-1 (ICAM-1, or CD54) is a 90 kDa member of the immunoglobulin (Ig) superfamily and is critical for the firm arrest and transmigration of leukocytes out of blood vessels and into tissues. ICAM-1 is constitutively present on endothelial cells, but its expression is increased by proinflammatory cytokines. The endothelial expression of ICAM-1 is increased in atherosclerotic and transplant-associated atherosclerotic tissue and in animal models of atherosclerosis. Additionally, ICAM-1 has been implicated in the progression of autoimmune diseases. ICAM-1 is a ligand for LFA-1(integrin). When activated, leukocytes bind to endothelial cells via ICAM-1/LFA-1 interaction and then transmigrate into tissues. Presence with heavy glycosylation and other structural characteristics, ICAM-1 possesses binding sites for a number of immune-associated ligands and serves as the binding site for entry of the major group of human Rhinovirus (HRV) into various cell types. ICAM-1 also becomes known for its affinity for Plasmodium falciparum-infected erythrocytes (PFIE), providing more of a role in infectious disease. Previous studies have shown that ICAM-1 is involved in inflammatory reactions and that a defect in ICAM-1 gene inhibits allergic contact hypersensitivity.

References
  • Xu H, et al. (2001) The role of ICAM-1 molecule in the migration of Langerhans cells in the skin and regional lymph node. Eur J Immunol. 31(10): 3085-93.
  • Terol MJ, et al. (2003) Soluble intercellular adhesion molecule-1 (s-ICAM-1/s-CD54) in diffuse large B-cell lymphoma: association with clinical characteristics and outcome. Ann Oncol. 14(3): 467-74.
  • Mendez MP, et al. (2006) Shedding of soluble ICAM-1 into the alveolar space in murine models of acute lung injury. Am J Physiol Lung Cell Mol Physiol. 290(5): L962-70.
  • Lawson C, et al. (2009) ICAM-1 signaling in endothelial cells. Pharmacol Rep. 61(1): 22-32.
  • Size / Price
    Catalog: MG50440-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"