CD5 cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG50403-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CD5 Reagents
CRO Services
Product recommended

All CD5 Reagents
CD5 cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1485 bp
Description
Full length Clone DNA of Mouse CD5 antigen with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD5 cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
Ly-1 cDNA ORF Clone, Mouse;Ly-12 cDNA ORF Clone, Mouse;Ly-A cDNA ORF Clone, Mouse;Lyt-1 cDNA ORF Clone, Mouse
CD5 Background Information

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD5 is a member of the CD system. CD5 was found to be widely distributed in T-cells and B1 cells which is a subset of IgM-secreting B cells. CD5 also was found expressed in small lymphocytic lymphoma, hairy cell leukaemia and mantle cell lymphoma cells. CD5 serves to weaken the activating stimulus from the BCR so that the B1 cells can only reflect to the very strong stimuli but not the normal tissue proteins.

Full Name
CD5 molecule
References
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters. 134 (2): 104-12.
  • Kirchgessner H, et al. (2001) The transmembrane adaptor protein TRIM regulates T cell receptor (TCR) expression and TCR-mediated signaling via an association with the TCR zeta chain. J Exp Med. 193 (11): 1269-84.
  • CD5 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    CD5 cDNA ORF Clone in Cloning Vector, Rhesus CG90176-G
    CD5 cDNA ORF Clone, Rhesus, untagged CG90176-UT
    CD5 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90176-ACG
    CD5 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90176-ACGLN
    CD5 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90176-ACR
    CD5 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90176-CF
    CD5 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90176-NF
    CD5 cDNA ORF Clone, Rhesus, C-His tag CG90176-CH
    CD5 cDNA ORF Clone, Rhesus, N-His tag CG90176-NH
    CD5 cDNA ORF Clone, Rhesus, C-HA tag CG90176-CY
    CD5 cDNA ORF Clone, Rhesus, N-HA tag CG90176-NY
    CD5 cDNA ORF Clone, Rhesus, C-Myc tag CG90176-CM
    CD5 cDNA ORF Clone, Rhesus, N-Myc tag CG90176-NM

    CD5 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CD5 cDNA ORF Clone in Cloning Vector, Rat RG80374-G
    CD5 cDNA ORF Clone, Rat, untagged RG80374-UT
    CD5 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80374-ACG
    CD5 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80374-ACGLN
    CD5 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80374-ACR
    CD5 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80374-CF
    CD5 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80374-NF
    CD5 cDNA ORF Clone, Rat, C-His tag RG80374-CH
    CD5 cDNA ORF Clone, Rat, N-His tag RG80374-NH
    CD5 cDNA ORF Clone, Rat, C-HA tag RG80374-CY
    CD5 cDNA ORF Clone, Rat, N-HA tag RG80374-NY
    CD5 cDNA ORF Clone, Rat, C-Myc tag RG80374-CM
    CD5 cDNA ORF Clone, Rat, N-Myc tag RG80374-NM
    CD5 qPCR Primer Pairs, Rat RP300341

    CD5 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CD5 cDNA ORF Clone in Cloning Vector, Mouse MG50403-M
    CD5 cDNA ORF Clone, Mouse, untagged MG50403-UT
    CD5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50403-ACGLN
    CD5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50403-ACG
    CD5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50403-ACR
    CD5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50403-CF
    CD5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50403-NF
    CD5 cDNA ORF Clone, Mouse, C-His tag MG50403-CH
    CD5 cDNA ORF Clone, Mouse, N-His tag MG50403-NH
    CD5 cDNA ORF Clone, Mouse, C-HA tag MG50403-CY
    CD5 cDNA ORF Clone, Mouse, N-HA tag MG50403-NY
    CD5 cDNA ORF Clone, Mouse, N-Myc tag MG50403-NM
    CD5 qPCR Primer Pairs, Mouse MP200420

    CD5 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CD5 cDNA ORF Clone in Cloning Vector, Human HG11027-M
    CD5 cDNA ORF Clone, Human, untagged HG11027-UT
    CD5 cDNA ORF Clone, Human, C-GFPSpark® tag HG11027-ACG
    CD5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11027-ACGLN
    CD5 cDNA ORF Clone, Human, C-OFPSpark® tag HG11027-ACR
    CD5 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11027-CF
    CD5 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11027-NF
    CD5 cDNA ORF Clone, Human, C-His tag HG11027-CH
    CD5 cDNA ORF Clone, Human, N-His tag HG11027-NH
    CD5 cDNA ORF Clone, Human, C-HA tag HG11027-CY
    CD5 cDNA ORF Clone, Human, N-HA tag HG11027-NY
    CD5 cDNA ORF Clone, Human, C-Myc tag HG11027-CM
    CD5 cDNA ORF Clone, Human, N-Myc tag HG11027-NM
    CD5 qPCR Primer Pairs, Human HP100986
    info info
    添加购物车成功! 添加购物车失败!