Quick Order

Mouse CD40 Ligand/CD40L/CD154 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Mouse CD40LG cDNA Clone Product Information
NCBI RefSeq:NM_011616.2
RefSeq ORF Size:783bp
cDNA Description:Full length Clone DNA of Mus musculus CD40 ligand.
Gene Synonym:IGM; IMD3; Ly62; TRAP; gp39; CD154; Cd40l; HIGM1; Ly-62; T-BAM; CD40-L; Tnfsf5
Species:Mouse
Vector:pCMV3-untagged
Plasmid:PCMV3-mCD40LG
Restriction Site:KpnI + XbaI (6.1kb + 0.78kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Mouse CD40LG Gene Plasmid Map
Mouse CD40LG natural ORF mammalian expression plasmid
Product nameProduct name
Background

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD154, also known as CD40 ligand or CD40L, is a member of the TNF superfamily. While CD154 was originally found on T cell surface, its expression has since been found on a wide variety of cells, including platelets, mast cells, macrophages and NK cells. CD154's ability is achieved through binding to the CD40 on antigen- presenting cells (APC). In the macrophage cells, the primary signal for activation is IFN-γ from Th1 type CD4 T cells. The secondary signal is CD40L on the T cell, which interacting with the CD40 molecules, helping increase the level of activation.

References
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Grewal IS, et al. (1998) CD40 and CD154 in cell-mediated immunity. Annual Review of Immunology. 16: 111-35.
  • Size / Price
    Catalog: MG50327-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
    • Mouse CD40LG natural ORF mammalian expression plasmid
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"