PD-L1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG50010-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PD-L1 Reagents
CRO Services
Product recommended

All PD-L1 Reagents
PD-L1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
873 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse CD274 antigen with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI + XbaI (6kb + 0.91kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
PD-L1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PD-L1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Validated Images
Mouse PD-L1/B7-H1/CD274 Gene Expression validated Image 2005
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
other Green fluorescent protein / GFP Gene Plasmid Map 5609
PD-L1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
A530045L16Rik cDNA ORF Clone, Mouse;B7h1 cDNA ORF Clone, Mouse;Pdcd1l1 cDNA ORF Clone, Mouse;Pdcd1lg1 cDNA ORF Clone, Mouse;Pdl1 cDNA ORF Clone, Mouse
PD-L1 Background Information

Programmed death-1 ligand-1 (PD-L1, CD274, B7-H1) has been identified as the ligand for the immunoinhibitory receptor programmed death-1(PD1/PDCD1) and has been demonstrated to play a role in the regulation of immune responses and peripheral tolerance. PD-L1/B7-H1 is a member of the growing B7 family of immune molecules and this protein contains one V-like and one C-like Ig domain within the extracellular domain, and together with PD-L2, are two ligands for PD1 which belongs to the CD28/CTLA4 family expressed on activated lymphoid cells. By binding to PD1 on activated T-cells and B-cells, PD-L1 may inhibit ongoing T-cell responses by inducing apoptosis and arresting cell-cycle progression. Accordingly, it leads to growth of immunogenic tumor growth by increasing apoptosis of antigen specific T cells and may contribute to immune evasion by cancers. PD-L1 thus is regarded as promising therapeutic target for human autoimmune disease and malignant cancers.

Immune Checkpoint
Immune Checkpoint Blockade: Blocking Antibodies   Immune Checkpoint Blockade: PD-L1 / B7-H1 / CD274 Blocking Antibodies
Immune Checkpoint Detection: Antibodies   Immune Checkpoint Detection: ELISA Antibodies   Immune Checkpoint Detection: IHC Antibodies   Immune Checkpoint Detection: ICC Antibodies   Immune Checkpoint Detection: FCM Antibodies   Immune Checkpoint Detection: WB Antibodies
Immune Checkpoint Proteins   PD-L1 / B7-H1 / CD274 Immune Checkpoint Proteins
Immune Checkpoint Targets   Co-inhibitory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
CD274 molecule
References
  • Iwai Y, et al. (2002) Involvement of PD-L1 on tumor cells in the escape from host immune system and tumor immunotherapy by PD-L1 blockade. Proc Natl Acad Sci U S A. 99(19): 12293-7.
  • Ghebeh H, et al. (2006) The B7-H1 (PD-L1) T lymphocyte-inhibitory molecule is expressed in breast cancer patients with infiltrating ductal carcinoma: correlation with important high-risk prognostic factors. Neoplasia. 8(3): 190-8.
  • Salih HR, et al. (2006) The role of leukemia-derived B7-H1 (PD-L1) in tumor-T-cell interactions in humans. Exp Hematol. 34(7): 888-94.
  • Wilcox RA, et al. (2009) B7-H1 (PD-L1, CD274) suppresses host immunity in T-cell lymphoproliferative disorders. Blood. 114(10): 2149-58.
  • Ruggiero A, et al. (2009) Crystal structure of PD-L1, a ribosome inactivating protein from Phytolacca dioica L. leaves with the property to induce DNA cleavage. Biopolymers. 91(12): 1135-42.
  • PD-L1 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    PD-L1 cDNA ORF Clone in Cloning Vector, Rhesus CG90251-G
    PD-L1 cDNA ORF Clone, Rhesus, untagged CG90251-UT
    PD-L1 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90251-ACG
    PD-L1 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90251-ACGLN
    PD-L1 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90251-ACR
    PD-L1 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90251-CF
    PD-L1 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90251-NF
    PD-L1 cDNA ORF Clone, Rhesus, C-His tag CG90251-CH
    PD-L1 cDNA ORF Clone, Rhesus, N-His tag CG90251-NH
    PD-L1 cDNA ORF Clone, Rhesus, C-HA tag CG90251-CY
    PD-L1 cDNA ORF Clone, Rhesus, N-HA tag CG90251-NY
    PD-L1 cDNA ORF Clone, Rhesus, C-Myc tag CG90251-CM
    PD-L1 cDNA ORF Clone, Rhesus, N-Myc tag CG90251-NM

    PD-L1 cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    PD-L1 cDNA ORF Clone in Cloning Vector, Canine DG70110-G
    PD-L1 cDNA ORF Clone, Canine, untagged DG70110-UT
    PD-L1 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70110-ACGLN
    PD-L1 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70110-ACG
    PD-L1 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70110-ACR
    PD-L1 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70110-CF
    PD-L1 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70110-NF
    PD-L1 cDNA ORF Clone, Canine, C-His tag DG70110-CH
    PD-L1 cDNA ORF Clone, Canine, N-His tag DG70110-NH
    PD-L1 cDNA ORF Clone, Canine, C-HA tag DG70110-CY
    PD-L1 cDNA ORF Clone, Canine, N-HA tag DG70110-NY
    PD-L1 cDNA ORF Clone, Canine, C-Myc tag DG70110-CM
    PD-L1 cDNA ORF Clone, Canine, N-Myc tag DG70110-NM

    PD-L1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    PD-L1 cDNA ORF Clone in Cloning Vector, Rat RG80450-G
    PD-L1 cDNA ORF Clone, Rat, untagged RG80450-UT
    PD-L1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80450-ACG
    PD-L1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80450-ACGLN
    PD-L1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80450-ACR
    PD-L1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80450-CF
    PD-L1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80450-NF
    PD-L1 cDNA ORF Clone, Rat, C-His tag RG80450-CH
    PD-L1 cDNA ORF Clone, Rat, N-His tag RG80450-NH
    PD-L1 cDNA ORF Clone, Rat, C-HA tag RG80450-CY
    PD-L1 cDNA ORF Clone, Rat, N-HA tag RG80450-NY
    PD-L1 cDNA ORF Clone, Rat, C-Myc tag RG80450-CM
    PD-L1 cDNA ORF Clone, Rat, N-Myc tag RG80450-NM
    PD-L1 qPCR Primer Pairs, Rat RP300417

    PD-L1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    PD-L1 cDNA ORF Clone in Cloning Vector, Mouse MG50010-M
    PD-L1 cDNA ORF Clone, Mouse, untagged MG50010-UT
    PD-L1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50010-ACGLN
    PD-L1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50010-ACG
    PD-L1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50010-ACR
    PD-L1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50010-NF
    PD-L1 cDNA ORF Clone, Mouse, C-His tag MG50010-CH
    PD-L1 cDNA ORF Clone, Mouse, N-His tag MG50010-NH
    PD-L1 cDNA ORF Clone, Mouse, C-HA tag MG50010-CY
    PD-L1 cDNA ORF Clone, Mouse, N-HA tag MG50010-NY
    PD-L1 cDNA ORF Clone, Mouse, C-Myc tag MG50010-CM
    PD-L1 cDNA ORF Clone, Mouse, N-Myc tag MG50010-NM
    PD-L1 qPCR Primer Pairs, Mouse MP200010

    PD-L1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    PD-L1 cDNA ORF Clone in Cloning Vector, Human HG10084-M
    PD-L1 cDNA ORF Clone, Human, untagged HG10084-UT
    PD-L1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10084-ACGLN
    PD-L1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10084-ACG
    PD-L1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10084-ACR
    PD-L1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10084-CF
    PD-L1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10084-NF
    PD-L1 cDNA ORF Clone, Human, C-His tag HG10084-CH
    PD-L1 cDNA ORF Clone, Human, N-His tag HG10084-NH
    PD-L1 cDNA ORF Clone, Human, C-HA tag HG10084-CY
    PD-L1 cDNA ORF Clone, Human, N-HA tag HG10084-NY
    PD-L1 cDNA ORF Clone, Human, C-Myc tag HG10084-CM
    PD-L1 cDNA ORF Clone, Human, N-Myc tag HG10084-NM
    PD-L1 qPCR Primer Pairs, Human HP100170
    info info
    添加购物车成功! 添加购物车失败!