SIGNR1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG50486-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SIGNR1 Reagents
CRO Services
Product recommended

All SIGNR1 Reagents
SIGNR1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
978 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse CD209b antigen with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI + XbaI (6kb + 1.03kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
SIGNR1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SIGNR1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Validated Images
Mouse SIGNR1/CD209b Gene Expression validated Image 2191
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
other Green fluorescent protein / GFP Gene Plasmid Map 5609
SIGNR1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
1810030I22Rik cDNA ORF Clone, Mouse;DC-SIGNR1 cDNA ORF Clone, Mouse;mSIGNR1 cDNA ORF Clone, Mouse;OtB7 cDNA ORF Clone, Mouse;SIGNR1 cDNA ORF Clone, Mouse
SIGNR1 Background Information

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD209b, also known as SIGNR1, is a C-type lectin receptor. CD209b is present on most regions of mouse brain and found on microglia and dendritic cells but not on neurons or astrocytes. CD209b is implicated in the recently described SIGNR1 complement activation pathway, which operates against capsular polysaccharides in splenic marginal macrophages. CD209b in rat is homologue to SIGNR1 in mouse, both of which are found to mediate the uptake of dextran or CPS14 within the splenic marginal zone.

Full Name
CD209b antigen
References
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Park JY, et al. (2009) The C-type lectin CD209b is expressed on microglia and it mediates the uptake of capsular polysaccharides of Streptococcus pneumonia. Neuroscience Letters. 450 (3): 246-51.
  • info info
    添加购物车成功! 添加购物车失败!