Quick Order

Mouse CD200R4 Gene ORF cDNA clone expression plasmid, N-HA tag

    DatasheetReviewsRelated ProductsProtocols
    Mouse CD200R4 cDNA Clone Product Information
    NCBI RefSeq:NM_207244.2
    RefSeq ORF Size:813bp
    cDNA Description:Full length Clone DNA of Mus musculus CD200 receptor 4 with N terminal HA tag.
    Gene Synonym:MCD200RLa, F630107N04Rik, Cd200r4
    Species:Mouse
    Vector:pCMV3-SP-N-HA
    Plasmid:
    Restriction Site:
    Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CD200R4 qPCR primers for gene expression analysis, MP200619 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Product nameProduct name
    Background

    Cell surface glycoprotein CD200 receptor 4, also known as Cell surface glycoprotein OX2 receptor 4, CD200 cell surface glycoprotein receptor-like 4, CD200RLa, and CD200R4, is a single-pass type I  membrane protein which belongs to the CD200R family. CD200 (OX2) is a cell surface glycoprotein that interacts with a structurally related receptor (CD200R) expressed mainly on myeloid cells and is involved in regulation of macrophage and mast cell function. In mouse there are up to five genes related to CD200R with conflicting data as to whether they bind CD200. CD200R4 contains one Ig-like C2-type (immunoglobulin-like) domain and one Ig-like V-type (immunoglobulin-like) domain. CD200R4 is highly expressed in monocytes, NK cells and a subset of NKT cells. It is weakly expressed in granulocytes and B cells (at protein level). CD200R4 is also expressed in brain, lung, testis, thymus, intestine and uterus. and in bone marrow derived-macrophage and dendritic cells and mast cells. CD200R4 is involved in the recruitment or surface expression of the TYROBP receptor.

    References
  • Wright, GJ. et al.,2003, J. Immunol. 171: 3034-46.
  • Gorczynski, R. et al., 2004,J. Immunol. 172:7744-7749.
  • Gorczynski, RM. et al.,2004, Am. J. Reprod. Immunol. 52:147-163.
  • Hatherley, D. et al.,2005. J. Immunol. 175: 2469-2474.
  • Size / Price
    Catalog: MG50639-NY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"