Quick Order

Text Size:AAA

Mouse CD200R4 Gene ORF cDNA clone expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Mouse CD200R4 cDNA Clone Product Information
NCBI RefSeq:NM_207244.2
RefSeq ORF Size:813bp
cDNA Description:Full length Clone DNA of Mus musculus CD200 receptor 4 with C terminal Myc tag.
Gene Synonym:MCD200RLa, F630107N04Rik, Cd200r4
Species:Mouse
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Mouse Cell surface glycoprotein CD200 receptor 4, also known as Cell surface glycoprotein OX2 receptor 4, CD200 cell surface glycoprotein receptor-like 4, CD200RLa, and CD200R4, is a single-pass type I  membrane protein which belongs to the CD200R family. CD200 (OX2) is a cell surface glycoprotein that interacts with a structurally related receptor (CD200R) expressed mainly on myeloid cells and is involved in regulation of macrophage and mast cell function. In mouse there are up to five genes related to CD200R with conflicting data as to whether they bind CD200. CD200R4 contains one Ig-like C2-type (immunoglobulin-like) domain and one Ig-like V-type (immunoglobulin-like) domain. CD200R4 is highly expressed in monocytes, NK cells and a subset of NKT cells. It is weakly expressed in granulocytes and B cells (at protein level). CD200R4 is also expressed in brain, lung, testis, thymus, intestine and uterus. and in bone marrow derived-macrophage and dendritic cells and mast cells. CD200R4 is involved in the recruitment or surface expression of the TYROBP receptor.

References
  • Wright, GJ. et al.,2003, J. Immunol. 171: 3034-46.
  • Gorczynski, R. et al., 2004,J. Immunol. 172:7744-7749.
  • Gorczynski, RM. et al.,2004, Am. J. Reprod. Immunol. 52:147-163.
  • Hatherley, D. et al.,2005. J. Immunol. 175: 2469-2474.
  • Size / Price
    Catalog: MG50639-CM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"