CD2 cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG50537-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CD2 Reagents
CRO Services
Product recommended

All CD2 Reagents
CD2 cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1035 bp
Description
Full length Clone DNA of Mouse CD2 antigen with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD2 cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
LFA-2 cDNA ORF Clone, Mouse;Ly-37 cDNA ORF Clone, Mouse;Ly37 cDNA ORF Clone, Mouse
CD2 Background Information

T-cell surface antigen CD2, also known as T-cell surface antigen T11/Leu-5, and SRBC, is a single-pass type I membrane protein. It contains one Ig-like C2-type domain and one Ig-like V-type domain. CD2 is a cell adhesion molecule expressed on T cells and is recognized as a target for CD48 (rats) and CD58 (humans). CD2 has been shown to set quantitative thresholds in T cell activation both in vivo and in vitro. Further, intracellular CD2 signaling pathways and networks are being discovered by the identification of several cytosolic tail binding proteins. CD2 interacts with lymphocyte function-associated antigen (LFA-3) and CD48/BCM1 to mediate adhesion between T-cells and other cell types. CD2 is implicated in the triggering of T-cells, the cytoplasmic domain of CD2 is implicated in the signaling function. The complex of CD2 and CD58 also plays an important role in enhancing the adhesion of T lymphocytes to target cells, and promoting hyperplasia and activation of T lymphocytes. As a cell surface glycoprotein, CD2 expressed on most human T cells and natural killer (NK) cells and plays an important role in mediating cell adhesion in both T-lymphocytes and in signal transduction.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
CD2 molecule
References
  • Yang JJ, et al. (2001) Structural biology of the cell adhesion protein CD2: alternatively folded states and structure-function relation. Curr Protein Pept Sci. 2(1): 1-17.
  • Wilkins AL, et al. (2003) Structural biology of the cell adhesion protein CD2: from molecular recognition to protein folding and design. Curr Protein Pept Sci. 4(5): 367-73.
  • McNerney ME, et al. (2006) The CD2 family of natural killer cell receptors. Curr Top Microbiol Immunol. 298: 91-120.
  • CD2 cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    CD2 cDNA ORF Clone in Cloning Vector, Canine DG70107-G

    CD2 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    CD2 cDNA ORF Clone in Cloning Vector, Rhesus CG90300-G
    CD2 cDNA ORF Clone, Rhesus, untagged CG90300-UT
    CD2 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90300-ACG
    CD2 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90300-ACGLN
    CD2 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90300-ACR
    CD2 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90300-CF
    CD2 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90300-NF
    CD2 cDNA ORF Clone, Rhesus, C-His tag CG90300-CH
    CD2 cDNA ORF Clone, Rhesus, N-His tag CG90300-NH
    CD2 cDNA ORF Clone, Rhesus, C-HA tag CG90300-CY
    CD2 cDNA ORF Clone, Rhesus, N-HA tag CG90300-NY
    CD2 cDNA ORF Clone, Rhesus, C-Myc tag CG90300-CM
    CD2 cDNA ORF Clone, Rhesus, N-Myc tag CG90300-NM

    CD2 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CD2 cDNA ORF Clone in Cloning Vector, Rat RG80158-G
    CD2 cDNA ORF Clone, Rat, untagged RG80158-UT
    CD2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80158-ACG
    CD2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80158-ACGLN
    CD2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80158-ACR
    CD2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80158-CF
    CD2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80158-NF
    CD2 cDNA ORF Clone, Rat, C-His tag RG80158-CH
    CD2 cDNA ORF Clone, Rat, N-His tag RG80158-NH
    CD2 cDNA ORF Clone, Rat, C-HA tag RG80158-CY
    CD2 cDNA ORF Clone, Rat, N-HA tag RG80158-NY
    CD2 cDNA ORF Clone, Rat, C-Myc tag RG80158-CM
    CD2 cDNA ORF Clone, Rat, N-Myc tag RG80158-NM
    CD2 qPCR Primer Pairs, Rat RP300214

    CD2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CD2 cDNA ORF Clone in Cloning Vector, Mouse MG50537-M
    CD2 cDNA ORF Clone, Mouse, untagged MG50537-UT
    CD2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50537-ACGLN
    CD2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50537-ACG
    CD2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50537-ACR
    CD2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50537-CF
    CD2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50537-NF
    CD2 cDNA ORF Clone, Mouse, C-His tag MG50537-CH
    CD2 cDNA ORF Clone, Mouse, N-His tag MG50537-NH
    CD2 cDNA ORF Clone, Mouse, C-HA tag MG50537-CY
    CD2 cDNA ORF Clone, Mouse, N-HA tag MG50537-NY
    CD2 cDNA ORF Clone, Mouse, N-Myc tag MG50537-NM
    CD2 qPCR Primer Pairs, Mouse MP200529

    CD2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CD2 cDNA ORF Clone in Cloning Vector, Human HG10982-M
    CD2 cDNA ORF Clone, Human, untagged HG10982-UT
    CD2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10982-ACGLN
    CD2 cDNA ORF Clone, Human, C-GFPSpark® tag HG10982-ACG
    CD2 cDNA ORF Clone, Human, C-OFPSpark® tag HG10982-ACR
    CD2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10982-CF
    CD2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10982-NF
    CD2 cDNA ORF Clone, Human, C-His tag HG10982-CH
    CD2 cDNA ORF Clone, Human, N-His tag HG10982-NH
    CD2 cDNA ORF Clone, Human, C-HA tag HG10982-CY
    CD2 cDNA ORF Clone, Human, N-HA tag HG10982-NY
    CD2 cDNA ORF Clone, Human, C-Myc tag HG10982-CM
    CD2 cDNA ORF Clone, Human, N-Myc tag HG10982-NM
    CD2 qPCR Primer Pairs, Human HP100947
    info info
    添加购物车成功! 添加购物车失败!