Text Size:AAA

Mouse CD2 Gene ORF cDNA clone expression plasmid, N-HA tag

    DatasheetReviewsRelated ProductsProtocols
    Mouse CD2 cDNA Clone Product Information
    NCBI RefSeq:NM_013486.2
    RefSeq ORF Size:1035bp
    cDNA Description:Full length Clone DNA of Mus musculus CD2 antigen with N terminal HA tag.
    Gene Synonym:Ly37, LFA-2, Ly-37, Cd2
    Species:Mouse
    Vector:pCMV3-SP-N-HA
    Plasmid:
    Restriction Site:
    Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CD2 qPCR primers for gene expression analysis, MP200529 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Product nameProduct name
    Background

    T-cell surface antigen CD2, also known as T-cell surface antigen T11/Leu-5, and SRBC, is a single-pass type I membrane protein. It contains one Ig-like C2-type domain and one Ig-like V-type domain. CD2 is a cell adhesion molecule expressed on T cells and is recognized as a target for CD48 (rats) and CD58 (humans). CD2 has been shown to set quantitative thresholds in T cell activation both in vivo and in vitro. Further, intracellular CD2 signaling pathways and networks are being discovered by the identification of several cytosolic tail binding proteins. CD2 interacts with lymphocyte function-associated antigen (LFA-3) and CD48/BCM1 to mediate adhesion between T-cells and other cell types. CD2 is implicated in the triggering of T-cells, the cytoplasmic domain of CD2 is implicated in the signaling function. The complex of CD2 and CD58 also plays an important role in enhancing the adhesion of T lymphocytes to target cells, and promoting hyperplasia and activation of T lymphocytes. As a cell surface glycoprotein, CD2 expressed on most human T cells and natural killer (NK) cells and plays an important role in mediating cell adhesion in both T-lymphocytes and in signal transduction.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    References
  • Yang JJ, et al. (2001) Structural biology of the cell adhesion protein CD2: alternatively folded states and structure-function relation. Curr Protein Pept Sci. 2(1): 1-17.
  • Wilkins AL, et al. (2003) Structural biology of the cell adhesion protein CD2: from molecular recognition to protein folding and design. Curr Protein Pept Sci. 4(5): 367-73.
  • McNerney ME, et al. (2006) The CD2 family of natural killer cell receptors. Curr Top Microbiol Immunol. 298: 91-120.
  • Size / Price
    Catalog: MG50537-NY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"