CD19 cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG50510-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CD19 Reagents
CRO Services
Product recommended

All CD19 Reagents
CD19 cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1689 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse CD19 antigen with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Restriction Sites
HindIII + NotI(6kb+1.69kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
CD19 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD19 cDNA ORF Clone, Mouse, C-Myc tag Validated Images
Human STAT3 Gene Plasmid Map 5650
CD19 cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
AW495831 cDNA ORF Clone, Mouse
CD19 Background Information

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. Cluster of differentiation 19 (CD19) is a member of CD system. CD19 is a cell surface molecule that assembles with the antigen receptor of B-cells. This results in a descent in threshold for antigen receptor-dependent stimulation. A simplified view holds that the ability of B-cells to respond to the various antigens in a specific and sensitive manner is achieved in the presence of low-affinity antigen receptors. CD19 primarily acts as a B-cell coreceptor in conjunction with CD21 and CD81. The formation of the receptor complex is induced by antigen and CD19, induced by exogenous antigen, has been found cytoplasmic tail phosphorylated and bind to sIg.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
CD19 molecule
References
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Carter RH, et al. (1992) CD19: lowering the threshold for antigen receptor stimulation of B lymphocytes. Science. 256 (5053): 105-7.
  • CD19 cDNA ORF Clone, Cynomolgus, Related Products

    Product Name Catalog#(PDF)
    CD19 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90051-G
    CD19 cDNA ORF Clone, Cynomolgus, untagged CG90051-UT
    CD19 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90051-ACG
    CD19 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90051-ACGLN
    CD19 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90051-ACR
    CD19 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90051-CF
    CD19 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90051-NF
    CD19 cDNA ORF Clone, Cynomolgus, C-His tag CG90051-CH
    CD19 cDNA ORF Clone, Cynomolgus, N-His tag CG90051-NH
    CD19 cDNA ORF Clone, Cynomolgus, C-HA tag CG90051-CY
    CD19 cDNA ORF Clone, Cynomolgus, N-HA tag CG90051-NY
    CD19 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90051-CM
    CD19 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90051-NM

    CD19 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CD19 cDNA ORF Clone in Cloning Vector, Mouse MG50510-M
    CD19 cDNA ORF Clone, Mouse, untagged MG50510-UT
    CD19 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50510-ACGLN
    CD19 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50510-ACG
    CD19 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50510-ACR
    CD19 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50510-CF
    CD19 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50510-NF
    CD19 cDNA ORF Clone, Mouse, C-His tag MG50510-CH
    CD19 cDNA ORF Clone, Mouse, N-His tag MG50510-NH
    CD19 cDNA ORF Clone, Mouse, C-HA tag MG50510-CY
    CD19 cDNA ORF Clone, Mouse, N-HA tag MG50510-NY
    CD19 cDNA ORF Clone, Mouse, N-Myc tag MG50510-NM
    CD19 qPCR Primer Pairs, Mouse MP200503

    CD19 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CD19 cDNA ORF Clone in Cloning Vector, Human HG11880-G
    CD19 cDNA ORF Clone, Human, untagged HG11880-UT
    CD19 cDNA ORF Clone, Human, C-GFPSpark® tag HG11880-ACG
    CD19 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11880-ACGLN
    CD19 cDNA ORF Clone, Human, C-OFPSpark® tag HG11880-ACR
    CD19 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11880-CF
    CD19 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11880-NF
    CD19 cDNA ORF Clone, Human, C-His tag HG11880-CH
    CD19 cDNA ORF Clone, Human, N-His tag HG11880-NH
    CD19 cDNA ORF Clone, Human, C-HA tag HG11880-CY
    CD19 cDNA ORF Clone, Human, N-HA tag HG11880-NY
    CD19 cDNA ORF Clone, Human, C-Myc tag HG11880-CM
    CD19 cDNA ORF Clone, Human, N-Myc tag HG11880-NM
    CD19 qPCR Primer Pairs, Human HP100100
    info info
    添加购物车成功! 添加购物车失败!