After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse CD166/ALCAM Gene ORF cDNA clone expression plasmid, C-HA tag

DatasheetReviewsRelated ProductsProtocols
Mouse ALCAM cDNA Clone Product Information
NCBI RefSeq:NM_009655.2
RefSeq ORF Size:1752bp
cDNA Description:Full length Clone DNA of Mus musculus activated leukocyte cell adhesion molecule with C terminal HA tag.
Gene Synonym:BEN, SC1, MuSC, CD166, AI853494, DM-GRASP, MGC27910
Species:Mouse
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Activated leukocyte cell adhesion molecule (ALCAM)/Cluster of differentiation (CD166) is a type I transmembrane cell adhesion molecule belonging to the Ig superfamily and a ligand for CD6 that is expressed on T lymphocytes. The extracellular domain of ALCAM contains five Ig-like domains (three Ig-like C2-type domains and two Ig-like V-type domains), of which the amino-terminal V1 domain is essential for ligand binding and ALCAM-mediated cell aggregation. ALCAM mediates both heterophilic (ALCAM-CD6) and homophilic (ALCAM-ALCAM) cell-cell interactions. ALCAM/CD6 interaction plays a role in T cell development and T cell regulation, as well as in the binding of T- and B-cells to activated leukocytes. Recently, homophilic (ALCAM-ALCAM) adhesion was shown to play important roles in tight cell-to-cell interaction and regulation of stem cell differentiation. While expressed in a wide variety of tissues, ALCAM is usually restricted to subsets of cells involved in dynamic growth and/or migration, including neural development, branching organ development, hematopoiesis, immune response and tumor progression. And CD166 is regarded as a potential novel breast cancer indicator and therapeutic target.

References
  • Swart GW. (2002) Activated leukocyte cell adhesion molecule (CD166/ALCAM): developmental and mechanistic aspects of cell clustering and cell migration. Eur J Cell Biol. 81(6): 313-21.
  • Fujiwara H, et al. (2003) Human blastocysts and endometrial epithelial cells express activated leukocyte cell adhesion molecule (ALCAM/CD166). J Clin Endocrinol Metab. 88(7): 3437-43.
  • Jezierska A, et al. (2006) ALCAM/CD166 protects breast cancer cells against apoptosis and autophagy. Med Sci Monit. 12(8): BR263-73.
  • Kahlert C, et al. (2009) Increased expression of ALCAM/CD166 in pancreatic cancer is an independent prognostic marker for poor survival and early tumour relapse. Br J Cancer. 101(3): 457-64.
  • Size / Price
    Catalog: MG50005-CY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"