Quick Order

Mouse CD157/BST1 Gene ORF cDNA clone expression plasmid

    DatasheetReviewsRelated ProductsProtocols
    Mouse BST1 cDNA Clone Product Information
    NCBI RefSeq:NM_008990.2
    RefSeq ORF Size:936bp
    cDNA Description:Full length Clone DNA of Mus musculus bone marrow stromal cell antigen 1.
    Gene Synonym:Bp3, BP-3, Ly65, Bsta1, CD157, 114/A10, A530073F09, Bst1
    Species:Mouse
    Vector:pCMV3-untagged
    Plasmid:
    Restriction Site:
    Tag Sequence:
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with BST1 qPCR primers for gene expression analysis, MP200342 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Product nameProduct name
    Background

    The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD157, also known as ADP-ribosyl cyclase 2, is an ectoenzyme sharing several characteristics with ADP-ribosyl cyclase CD38. CD157 was originally identified as a bone marrow stromal cell molecule (BST-1) with a glycosylphosphatidylinositol (GPI) anchor to bind to the cell surface. CD157 is prevalently expressed by cells of the myeloid lineage. CD157 could act as a receptor with signal transduction capability. Further, it regulates calcium homeostasis and promotes polarization in neutrophils and mediates superoxide (O2−) production in the human U937 myeloid line.

    References
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Malavasi F, et al. (2006) CD38 and CD157 as Receptors of the Immune System: A Bridge Between Innate and Adaptive Immunity. Molecular Medicine. 12 (11-12): 334-41.
  • Ortolan E, et al. (2002) CD157, the janus of CD38 but with a unique personality. Cell Biochemistry and Function. 20 (4): 309-22.
  • Size / Price
    Catalog: MG50319-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"