VE-Cadherin cDNA ORF Clone, Mouse, N-His tag

Cat: MG50192-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All VE-Cadherin Reagents
CRO Services
Product recommended

All VE-Cadherin Reagents
VE-Cadherin cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2355 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse cadherin 5 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Restriction Sites
KpnI + XbaI (6kb + 2.38kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
VE-Cadherin cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

VE-Cadherin cDNA ORF Clone, Mouse, N-His tag Validated Images
Rhesus CD3d/CD3 delta Gene Plasmid Map 5615
VE-Cadherin cDNA ORF Clone, Mouse, N-His tag Alternative Names
7B4 cDNA ORF Clone, Mouse;AA408225 cDNA ORF Clone, Mouse;Cd144 cDNA ORF Clone, Mouse;VE-Cad cDNA ORF Clone, Mouse;Vec cDNA ORF Clone, Mouse;VEcad cDNA ORF Clone, Mouse;VECD cDNA ORF Clone, Mouse
VE-Cadherin Background Information

Cadherins (Calcium dependent adhesion molecules) are a class of transmembrane proteins. Cadherin-5, also known as VE-cadherin, CDH5 and CD144, an endothelial specific cell-cell adhesion molecule, plays a pivotal role in the formation, maturation and remodeling of the vascular wall. VE-Cadherin is widely considered to be specific for vascular endothelia in which it is either the sole or the predominant cadherin, often co-existing with N-cadherin. This specificity of VE-cadherin for vascular endothelial cells is important not only in blood and lymph vessel biology and medicine, but also for cell-type-based diagnoses, notably those of metastatic tumors. As a classical cadherin, VE-Cadherin links endothelial cells together by homophilic interactions mediated by its extracellular part and associates intracellularly with the actin cytoskeleton via catenins. Mechanisms that regulate VE-cadherin-mediated adhesion are important for the control of vascular permeability and leukocyte extravasation. In addition to its adhesive functions, VE-Cadherin regulates various cellular processes such as cell proliferation and apoptosis and modulates vascular endothelial growth factor receptor functions. Consequently, VE-cadherin is essential during embryonic angiogenesis.

Full Name
cadherin 5, type 2 (vascular endothelium)
References
  • Taveau JC, et al. (2008) Structure of artificial and natural VE-cadherin-based adherens junctions. Biochem Soc Trans. 36(Pt 2): 189-93.
  • Vestweber D. (2008) VE-cadherin: the major endothelial adhesion molecule controlling cellular junctions and blood vessel formation. Arterioscler Thromb Vasc Biol. 28(2): 223-32.
  • Gavard J. (2009) Breaking the VE-cadherin bonds. FEBS Lett. 583(1): 1-6.
  • Vestweber D, et al. (2009) Cell adhesion dynamics at endothelial junctions: VE-cadherin as a major player. Trends Cell Biol. 19(1): 8-15.
  • Boda-Heggemann J, et al. (2009) Beyond vessels: occurrence and regional clustering of vascular endothelial (VE-)cadherin-containing junctions in non-endothelial cells. Cell Tissue Res. 335(1): 49-65.
  • VE-Cadherin cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    VE-Cadherin cDNA ORF Clone in Cloning Vector, Rat RG80276-G
    VE-Cadherin cDNA ORF Clone, Rat, untagged RG80276-UT
    VE-Cadherin cDNA ORF Clone, Rat, C-GFPSpark® tag RG80276-ACG
    VE-Cadherin Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80276-ACGLN
    VE-Cadherin cDNA ORF Clone, Rat, C-OFPSpark® tag RG80276-ACR
    VE-Cadherin cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80276-CF
    VE-Cadherin cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80276-NF
    VE-Cadherin cDNA ORF Clone, Rat, C-His tag RG80276-CH
    VE-Cadherin cDNA ORF Clone, Rat, N-His tag RG80276-NH
    VE-Cadherin cDNA ORF Clone, Rat, C-HA tag RG80276-CY
    VE-Cadherin cDNA ORF Clone, Rat, N-HA tag RG80276-NY
    VE-Cadherin cDNA ORF Clone, Rat, C-Myc tag RG80276-CM
    VE-Cadherin cDNA ORF Clone, Rat, N-Myc tag RG80276-NM
    VE-Cadherin qPCR Primer Pairs, Rat RP300400

    VE-Cadherin cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    VE-Cadherin cDNA ORF Clone in Cloning Vector, Mouse MG50192-M
    VE-Cadherin cDNA ORF Clone, Mouse, untagged MG50192-UT
    VE-Cadherin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50192-ACGLN
    VE-Cadherin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50192-ACG
    VE-Cadherin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50192-ACR
    VE-Cadherin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50192-CF
    VE-Cadherin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50192-NF
    VE-Cadherin cDNA ORF Clone, Mouse, C-His tag MG50192-CH
    VE-Cadherin cDNA ORF Clone, Mouse, C-HA tag MG50192-CY
    VE-Cadherin cDNA ORF Clone, Mouse, N-HA tag MG50192-NY
    VE-Cadherin cDNA ORF Clone, Mouse, C-Myc tag MG50192-CM
    VE-Cadherin cDNA ORF Clone, Mouse, N-Myc tag MG50192-NM
    VE-Cadherin qPCR Primer Pairs, Mouse MP200222

    VE-Cadherin cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    VE-Cadherin cDNA ORF Clone in Cloning Vector, Human HG10433-M
    VE-Cadherin cDNA ORF Clone, Human, untagged HG10433-UT
    VE-Cadherin cDNA ORF Clone, Human, C-GFPSpark® tag HG10433-ACG
    VE-Cadherin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10433-ACGLN
    VE-Cadherin cDNA ORF Clone, Human, C-OFPSpark® tag HG10433-ACR
    VE-Cadherin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10433-CF
    VE-Cadherin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10433-NF
    VE-Cadherin cDNA ORF Clone, Human, C-His tag HG10433-CH
    VE-Cadherin cDNA ORF Clone, Human, N-His tag HG10433-NH
    VE-Cadherin cDNA ORF Clone, Human, C-HA tag HG10433-CY
    VE-Cadherin cDNA ORF Clone, Human, N-HA tag HG10433-NY
    VE-Cadherin cDNA ORF Clone, Human, C-Myc tag HG10433-CM
    VE-Cadherin cDNA ORF Clone, Human, N-Myc tag HG10433-NM
    VE-Cadherin qPCR Primer Pairs, Human HP100463
    info info
    添加购物车成功! 添加购物车失败!