CCT4/TCP1 delta cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG52257-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CCT4/TCP1 delta Reagents
CRO Services
Product recommended

All CCT4/TCP1 delta Reagents
CCT4/TCP1 delta cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1620 bp
Description
Full length Clone DNA of Mouse chaperonin containing Tcp1, subunit 4 (delta) with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CCT4/TCP1 delta cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
2610204B21Rik cDNA ORF Clone, Mouse;A45 cDNA ORF Clone, Mouse;C78323 cDNA ORF Clone, Mouse;Cctd cDNA ORF Clone, Mouse
CCT4/TCP1 delta Background Information
Full Name
chaperonin containing TCP1, subunit 4 (delta)

CCT4/TCP1 delta cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CCT4/TCP1 delta cDNA ORF Clone in Cloning Vector, Mouse MG52257-U
CCT4/TCP1 delta cDNA ORF Clone, Mouse, untagged MG52257-UT
CCT4/TCP1 delta Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52257-ACGLN
CCT4/TCP1 delta cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52257-ACG
CCT4/TCP1 delta cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52257-ANG
CCT4/TCP1 delta cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52257-ACR
CCT4/TCP1 delta cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52257-ANR
CCT4/TCP1 delta cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52257-NF
CCT4/TCP1 delta cDNA ORF Clone, Mouse, C-His tag MG52257-CH
CCT4/TCP1 delta cDNA ORF Clone, Mouse, N-His tag MG52257-NH
CCT4/TCP1 delta cDNA ORF Clone, Mouse, C-HA tag MG52257-CY
CCT4/TCP1 delta cDNA ORF Clone, Mouse, N-HA tag MG52257-NY
CCT4/TCP1 delta cDNA ORF Clone, Mouse, C-Myc tag MG52257-CM
CCT4/TCP1 delta cDNA ORF Clone, Mouse, N-Myc tag MG52257-NM
CCT4/TCP1 delta qPCR Primer Pairs, Mouse MP202130

CCT4/TCP1 delta cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CCT4/TCP1 delta cDNA ORF Clone in Cloning Vector, Human HG15784-G
CCT4/TCP1 delta cDNA ORF Clone, Human, untagged HG15784-UT
CCT4/TCP1 delta cDNA ORF Clone, Human, C-GFPSpark® tag HG15784-ACG
CCT4/TCP1 delta Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15784-ACGLN
CCT4/TCP1 delta cDNA ORF Clone, Human, N-GFPSpark® tag HG15784-ANG
CCT4/TCP1 delta cDNA ORF Clone, Human, C-OFPSpark® tag HG15784-ACR
CCT4/TCP1 delta cDNA ORF Clone, Human, N-OFPSpark® tag HG15784-ANR
CCT4/TCP1 delta cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15784-CF
CCT4/TCP1 delta cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15784-NF
CCT4/TCP1 delta cDNA ORF Clone, Human, C-His tag HG15784-CH
CCT4/TCP1 delta cDNA ORF Clone, Human, N-His tag HG15784-NH
CCT4/TCP1 delta cDNA ORF Clone, Human, C-HA tag HG15784-CY
CCT4/TCP1 delta cDNA ORF Clone, Human, N-HA tag HG15784-NY
CCT4/TCP1 delta cDNA ORF Clone, Human, C-Myc tag HG15784-CM
CCT4/TCP1 delta cDNA ORF Clone, Human, N-Myc tag HG15784-NM
CCT4/TCP1 delta qPCR Primer Pairs, Human HP104375
info info
添加购物车成功! 添加购物车失败!