Quick Order

Mouse CCR7 Gene ORF cDNA clone expression plasmid, N-His tag

  • Rhesus CD3d/CD3 delta Gene Plasmid Map 5615
DatasheetReviewsRelated ProductsProtocols
Mouse CCR7 cDNA Clone Product Information
NCBI RefSeq:NM_007719.2
RefSeq ORF Size:1227 bp
cDNA Description:Full length Clone DNA of Mus musculus chemokine (C-C motif) receptor 7 with N terminal His tag.
Gene Synonym:EBI1, CD197, Ebi1h, Cdw197, Cmkbr7, Ccr7
Species:Mouse
Vector:pCMV3-SP-N-His
Plasmid:pCMV3-His-mCCR7
Restriction Site:KpnI + XbaI(6kb+1.23kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 348A/G,1059C/T not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with CCR7 qPCR primers for gene expression analysis, MP200844 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Size / Price
Catalog: MG50873-NH
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
AvailabilityIn Stock
Add to CartBulk Discount Inquiry

Datasheet & Documentation

Contact Us
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"