CCR5 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG50871-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CCR5 Reagents
CRO Services
Product recommended

All CCR5 Reagents
CCR5 cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1065 bp
Description
Full length Clone DNA of Mouse chemokine (C-C motif) receptor 5 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CCR5 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
AM4-7 cDNA ORF Clone, Mouse;CD195 cDNA ORF Clone, Mouse;Cmkbr5 cDNA ORF Clone, Mouse
CCR5 Background Information
Full Name
chemokine (C-C motif) receptor 5 (gene/pseudogene)

CCR5 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
CCR5 cDNA ORF Clone in Cloning Vector, Rhesus CG90233-G
CCR5 cDNA ORF Clone, Rhesus, untagged CG90233-UT
CCR5 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90233-ACG
CCR5 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90233-ACGLN
CCR5 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90233-ACR
CCR5 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90233-CF
CCR5 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90233-NF
CCR5 cDNA ORF Clone, Rhesus, C-His tag CG90233-CH
CCR5 cDNA ORF Clone, Rhesus, N-His tag CG90233-NH
CCR5 cDNA ORF Clone, Rhesus, C-HA tag CG90233-CY
CCR5 cDNA ORF Clone, Rhesus, N-HA tag CG90233-NY
CCR5 cDNA ORF Clone, Rhesus, C-Myc tag CG90233-CM
CCR5 cDNA ORF Clone, Rhesus, N-Myc tag CG90233-NM

CCR5 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CCR5 cDNA ORF Clone in Cloning Vector, Rat RG80358-G
CCR5 cDNA ORF Clone, Rat, untagged RG80358-UT
CCR5 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80358-ACGLN
CCR5 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80358-ACG
CCR5 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80358-ACR
CCR5 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80358-CF
CCR5 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80358-NF
CCR5 cDNA ORF Clone, Rat, C-His tag RG80358-CH
CCR5 cDNA ORF Clone, Rat, N-His tag RG80358-NH
CCR5 cDNA ORF Clone, Rat, C-HA tag RG80358-CY
CCR5 cDNA ORF Clone, Rat, N-HA tag RG80358-NY
CCR5 cDNA ORF Clone, Rat, C-Myc tag RG80358-CM
CCR5 cDNA ORF Clone, Rat, N-Myc tag RG80358-NM
CCR5 qPCR Primer Pairs, Rat RP300328

CCR5 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CCR5 cDNA ORF Clone in Cloning Vector, Mouse MG50871-G
CCR5 cDNA ORF Clone, Mouse, untagged MG50871-UT
CCR5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50871-ACGLN
CCR5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50871-ACG
CCR5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50871-ACR
CCR5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50871-CF
CCR5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50871-NF
CCR5 cDNA ORF Clone, Mouse, C-His tag MG50871-CH
CCR5 cDNA ORF Clone, Mouse, N-His tag MG50871-NH
CCR5 cDNA ORF Clone, Mouse, C-HA tag MG50871-CY
CCR5 cDNA ORF Clone, Mouse, N-HA tag MG50871-NY
CCR5 cDNA ORF Clone, Mouse, C-Myc tag MG50871-CM
CCR5 qPCR Primer Pairs, Mouse MP200842

CCR5 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CCR5 cDNA ORF Clone in Cloning Vector, Human HG13022-M
CCR5 cDNA ORF Clone, Human, untagged HG13022-UT
CCR5 cDNA ORF Clone, Human, C-GFPSpark® tag HG13022-ACG
CCR5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13022-ACGLN
CCR5 cDNA ORF Clone, Human, N-GFPSpark® tag HG13022-ANG
CCR5 cDNA ORF Clone, Human, C-OFPSpark® tag HG13022-ACR
CCR5 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13022-CF
CCR5 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13022-NF
CCR5 cDNA ORF Clone, Human, C-His tag HG13022-CH
CCR5 cDNA ORF Clone, Human, N-His tag HG13022-NH
CCR5 cDNA ORF Clone, Human, C-HA tag HG13022-CY
CCR5 cDNA ORF Clone, Human, N-HA tag HG13022-NY
CCR5 cDNA ORF Clone, Human, C-Myc tag HG13022-CM
CCR5 cDNA ORF Clone, Human, N-Myc tag HG13022-NM
CCR5 qPCR Primer Pairs, Human HP101679
info info
添加购物车成功! 添加购物车失败!