Cyclin H cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG50932-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Cyclin H Reagents
CRO Services
Product recommended

All Cyclin H Reagents
Cyclin H cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
972 bp
Description
Full length Clone DNA of Mouse cyclin H with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Cyclin H cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
6330408H09Rik cDNA ORF Clone, Mouse;AI661354 cDNA ORF Clone, Mouse;AV102684 cDNA ORF Clone, Mouse;AW538719 cDNA ORF Clone, Mouse
Cyclin H Background Information
Full Name
cyclin H

Cyclin H cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Cyclin H cDNA ORF Clone in Cloning Vector, Mouse MG50932-G
Cyclin H cDNA ORF Clone, Mouse, untagged MG50932-UT
Cyclin H cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50932-ACG
Cyclin H Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50932-ACGLN
Cyclin H cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50932-ANG
Cyclin H cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50932-ACR
Cyclin H cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50932-ANR
Cyclin H cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50932-CF
Cyclin H cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50932-NF
Cyclin H cDNA ORF Clone, Mouse, C-His tag MG50932-CH
Cyclin H cDNA ORF Clone, Mouse, N-His tag MG50932-NH
Cyclin H cDNA ORF Clone, Mouse, C-HA tag MG50932-CY
Cyclin H cDNA ORF Clone, Mouse, N-HA tag MG50932-NY
Cyclin H cDNA ORF Clone, Mouse, C-Myc tag MG50932-CM
Cyclin H qPCR Primer Pairs, Mouse MP200901

Cyclin H cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Cyclin H cDNA ORF Clone in Cloning Vector, Human HG10916-M
Cyclin H cDNA ORF Clone, Human, untagged HG10916-UT
Cyclin H Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10916-ACGLN
Cyclin H cDNA ORF Clone, Human, C-GFPSpark® tag HG10916-ACG
Cyclin H cDNA ORF Clone, Human, N-GFPSpark® tag HG10916-ANG
Cyclin H cDNA ORF Clone, Human, C-OFPSpark® tag HG10916-ACR
Cyclin H cDNA ORF Clone, Human, N-OFPSpark® tag HG10916-ANR
Cyclin H cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10916-CF
Cyclin H cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10916-NF
Cyclin H cDNA ORF Clone, Human, C-His tag HG10916-CH
Cyclin H cDNA ORF Clone, Human, N-His tag HG10916-NH
Cyclin H cDNA ORF Clone, Human, C-HA tag HG10916-CY
Cyclin H cDNA ORF Clone, Human, N-HA tag HG10916-NY
Cyclin H cDNA ORF Clone, Human, C-Myc tag HG10916-CM
Cyclin H cDNA ORF Clone, Human, N-Myc tag HG10916-NM
Cyclin H qPCR Primer Pairs, Human HP100799
info info
添加购物车成功! 添加购物车失败!