CCNDBP1 cDNA ORF Clone, Mouse, C-HA tag

Cat: MG51818-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CCNDBP1 Reagents
CRO Services
Product recommended

All CCNDBP1 Reagents
CCNDBP1 cDNA ORF Clone, Mouse, C-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1071 bp
Description
Full length Clone DNA of Mouse cyclin D-type binding-protein 1 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CCNDBP1 cDNA ORF Clone, Mouse, C-HA tag Alternative Names
AU022347 cDNA ORF Clone, Mouse;DIP1 cDNA ORF Clone, Mouse;GCIP cDNA ORF Clone, Mouse;Maid cDNA ORF Clone, Mouse;SECC-8 cDNA ORF Clone, Mouse;SSEC-8 cDNA ORF Clone, Mouse
CCNDBP1 Background Information
Full Name
cyclin D-type binding-protein 1

CCNDBP1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CCNDBP1 cDNA ORF Clone in Cloning Vector, Mouse MG51818-G
CCNDBP1 cDNA ORF Clone, Mouse, untagged MG51818-UT
CCNDBP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51818-ACGLN
CCNDBP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51818-ACG
CCNDBP1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51818-ANG
CCNDBP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51818-ACR
CCNDBP1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51818-ANR
CCNDBP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51818-CF
CCNDBP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51818-NF
CCNDBP1 cDNA ORF Clone, Mouse, C-His tag MG51818-CH
CCNDBP1 cDNA ORF Clone, Mouse, N-His tag MG51818-NH
CCNDBP1 cDNA ORF Clone, Mouse, N-HA tag MG51818-NY
CCNDBP1 cDNA ORF Clone, Mouse, C-Myc tag MG51818-CM
CCNDBP1 cDNA ORF Clone, Mouse, N-Myc tag MG51818-NM
CCNDBP1 qPCR Primer Pairs, Mouse MP201691

CCNDBP1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CCNDBP1 cDNA ORF Clone in Cloning Vector, Human HG12509-U
CCNDBP1 cDNA ORF Clone, Human, untagged HG12509-UT
CCNDBP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG12509-ACG
CCNDBP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12509-ACGLN
CCNDBP1 cDNA ORF Clone, Human, N-GFPSpark® tag HG12509-ANG
CCNDBP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG12509-ACR
CCNDBP1 cDNA ORF Clone, Human, N-OFPSpark® tag HG12509-ANR
CCNDBP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12509-CF
CCNDBP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12509-NF
CCNDBP1 cDNA ORF Clone, Human, C-His tag HG12509-CH
CCNDBP1 cDNA ORF Clone, Human, N-His tag HG12509-NH
CCNDBP1 cDNA ORF Clone, Human, C-HA tag HG12509-CY
CCNDBP1 cDNA ORF Clone, Human, N-HA tag HG12509-NY
CCNDBP1 cDNA ORF Clone, Human, C-Myc tag HG12509-CM
CCNDBP1 cDNA ORF Clone, Human, N-Myc tag HG12509-NM
info info
添加购物车成功! 添加购物车失败!