Cyclin D3 cDNA ORF Clone, Mouse, N-HA tag

Cat: MG51039-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Cyclin D3 Reagents
CRO Services
Product recommended

All Cyclin D3 Reagents
Cyclin D3 cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
879 bp
Description
Full length Clone DNA of Mouse cyclin D3 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Cyclin D3 cDNA ORF Clone, Mouse, N-HA tag Alternative Names
9230106B05Rik cDNA ORF Clone, Mouse;AA682053 cDNA ORF Clone, Mouse;AL024085 cDNA ORF Clone, Mouse;AW146355 cDNA ORF Clone, Mouse;C78795 cDNA ORF Clone, Mouse
Cyclin D3 Background Information
Full Name
cyclin D3

Cyclin D3 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
Cyclin D3 cDNA ORF Clone in Cloning Vector, Rhesus CG90783-G
Cyclin D3 cDNA ORF Clone, Rhesus, untagged CG90783-UT
Cyclin D3 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90783-ACG
Cyclin D3 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90783-ACGLN
Cyclin D3 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90783-ANG
Cyclin D3 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90783-ACR
Cyclin D3 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90783-ANR
Cyclin D3 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90783-CF
Cyclin D3 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90783-NF
Cyclin D3 cDNA ORF Clone, Rhesus, C-His tag CG90783-CH
Cyclin D3 cDNA ORF Clone, Rhesus, N-His tag CG90783-NH
Cyclin D3 cDNA ORF Clone, Rhesus, C-HA tag CG90783-CY
Cyclin D3 cDNA ORF Clone, Rhesus, N-HA tag CG90783-NY
Cyclin D3 cDNA ORF Clone, Rhesus, C-Myc tag CG90783-CM
Cyclin D3 cDNA ORF Clone, Rhesus, N-Myc tag CG90783-NM

Cyclin D3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Cyclin D3 cDNA ORF Clone in Cloning Vector, Mouse MG51039-G
Cyclin D3 cDNA ORF Clone, Mouse, untagged MG51039-UT
Cyclin D3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51039-ACGLN
Cyclin D3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51039-ACG
Cyclin D3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51039-ANG
Cyclin D3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51039-ACR
Cyclin D3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51039-ANR
Cyclin D3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51039-CF
Cyclin D3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51039-NF
Cyclin D3 cDNA ORF Clone, Mouse, C-His tag MG51039-CH
Cyclin D3 cDNA ORF Clone, Mouse, N-His tag MG51039-NH
Cyclin D3 cDNA ORF Clone, Mouse, C-HA tag MG51039-CY
Cyclin D3 cDNA ORF Clone, Mouse, C-Myc tag MG51039-CM
Cyclin D3 cDNA ORF Clone, Mouse, N-Myc tag MG51039-NM
Cyclin D3 qPCR Primer Pairs, Mouse MP200998

Cyclin D3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Cyclin D3 cDNA ORF Clone in Cloning Vector, Human HG10923-M
Cyclin D3 cDNA ORF Clone, Human, untagged HG10923-UT
Cyclin D3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10923-ACGLN
Cyclin D3 cDNA ORF Clone, Human, C-GFPSpark® tag HG10923-ACG
Cyclin D3 cDNA ORF Clone, Human, N-GFPSpark® tag HG10923-ANG
Cyclin D3 cDNA ORF Clone, Human, C-OFPSpark® tag HG10923-ACR
Cyclin D3 cDNA ORF Clone, Human, N-OFPSpark® tag HG10923-ANR
Cyclin D3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10923-CF
Cyclin D3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10923-NF
Cyclin D3 cDNA ORF Clone, Human, C-His tag HG10923-CH
Cyclin D3 cDNA ORF Clone, Human, N-His tag HG10923-NH
Cyclin D3 cDNA ORF Clone, Human, C-HA tag HG10923-CY
Cyclin D3 cDNA ORF Clone, Human, N-HA tag HG10923-NY
Cyclin D3 cDNA ORF Clone, Human, C-Myc tag HG10923-CM
Cyclin D3 cDNA ORF Clone, Human, N-Myc tag HG10923-NM
Cyclin D3 qPCR Primer Pairs, Human HP100805
info info
添加购物车成功! 添加购物车失败!