Cyclin C cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG50898-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Cyclin C Reagents
CRO Services
Product recommended

All Cyclin C Reagents
Cyclin C cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
849 bp
Description
Full length Clone DNA of Mouse cyclin C with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Cyclin C cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
AI451004 cDNA ORF Clone, Mouse;AU020987 cDNA ORF Clone, Mouse;CG1C cDNA ORF Clone, Mouse
Cyclin C Background Information
Full Name
cyclin C

Cyclin C cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Cyclin C cDNA ORF Clone in Cloning Vector, Mouse MG50898-G
Cyclin C cDNA ORF Clone, Mouse, untagged MG50898-UT
Cyclin C cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50898-ACG
Cyclin C Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50898-ACGLN
Cyclin C cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50898-ANG
Cyclin C cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50898-ACR
Cyclin C cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50898-ANR
Cyclin C cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50898-CF
Cyclin C cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50898-NF
Cyclin C cDNA ORF Clone, Mouse, C-His tag MG50898-CH
Cyclin C cDNA ORF Clone, Mouse, N-His tag MG50898-NH
Cyclin C cDNA ORF Clone, Mouse, C-HA tag MG50898-CY
Cyclin C cDNA ORF Clone, Mouse, N-HA tag MG50898-NY
Cyclin C cDNA ORF Clone, Mouse, C-Myc tag MG50898-CM
Cyclin C qPCR Primer Pairs, Mouse MP200869

Cyclin C cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Cyclin C cDNA ORF Clone in Cloning Vector, Human HG10914-M
Cyclin C cDNA ORF Clone, Human, untagged HG10914-UT
Cyclin C cDNA ORF Clone, Human, C-GFPSpark® tag HG10914-ACG
Cyclin C Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10914-ACGLN
Cyclin C cDNA ORF Clone, Human, N-GFPSpark® tag HG10914-ANG
Cyclin C cDNA ORF Clone, Human, C-OFPSpark® tag HG10914-ACR
Cyclin C cDNA ORF Clone, Human, N-OFPSpark® tag HG10914-ANR
Cyclin C cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10914-CF
Cyclin C cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10914-NF
Cyclin C cDNA ORF Clone, Human, C-His tag HG10914-CH
Cyclin C cDNA ORF Clone, Human, N-His tag HG10914-NH
Cyclin C cDNA ORF Clone, Human, C-HA tag HG10914-CY
Cyclin C cDNA ORF Clone, Human, N-HA tag HG10914-NY
Cyclin C cDNA ORF Clone, Human, C-Myc tag HG10914-CM
Cyclin C cDNA ORF Clone, Human, N-Myc tag HG10914-NM
Cyclin C qPCR Primer Pairs, Human HP100797
info info
添加购物车成功! 添加购物车失败!