MCP3 cDNA ORF Clone, Mouse, N-HA tag

Cat: MG50627-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MCP3 Reagents
CRO Services
Product recommended

All MCP3 Reagents
MCP3 cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
294 bp
Description
Full length Clone DNA of Mouse chemokine (C-C motif) ligand 7 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MCP3 cDNA ORF Clone, Mouse, N-HA tag Alternative Names
fic cDNA ORF Clone, Mouse;marc cDNA ORF Clone, Mouse;MCP-3 cDNA ORF Clone, Mouse;mcp3 cDNA ORF Clone, Mouse;Scya7 cDNA ORF Clone, Mouse
MCP3 Background Information

Chemokines are a family of small chemotactic cytokines, or proteins secreted by cells. Chemokines share the same structure similarities such as small size, and the presence of four cysteine residues in conserved locations in order to form their 3-dimensional shape. Some of the chemokines are considered pro-inflammatory which can be induced to recruit cells of the immune system to a site of infection during an immune response, while others are considered homeostatic and are implied in controlling the migration of cells during normal processes of tissue maintenance and development. There are four members of the chemokine family: C-C kemokines, C kemokines, CXC kemokines and CX3C kemokines. The C-C kemokines have two cysteines nearby the amino terminus. There have been at least 27 distinct members of this subgroup reported for mammals, called C-C chemokine ligands-1 to 28. Chemokine ligand 7(CCL7), also known as MCP-3, is a isform of the C-C chemokine subfamily of the chemokine family which is produced by certain tumor cells and by macrophages. It also own two adjacent N-terminal cysteine residues. Chemokine ligand 7(CCL7) spacifically attracts monocytes, and regulates macrophage function.

Full Name
chemokine (C-C motif) ligand 7
References
  • Laing KJ, et al. (2004) Chemokines. Developmental and comparative immunology. 28(5): 443-60.
  • Cocchi F, et al. (1995) Identification of RANTES, MIP-1a, and MIP-1b as the major HIV-suppressive factor produced by CD8+ T cells. Science. 270 (5243): 1811-5.
  • Michalec L, et al. (2002) CCL7 and CXCL10 Orchestrate Oxidative Stress-Induced Neutrophilic Lung Inflammation. The Journal of Immunology. 168: 846-52.
  • Wetzel K,et al. (2007) MCP-3 (CCL7) delivered by parvovirus MVMp reduces tumorigenicity of mouse melanoma cells through activation of T lymphocytes and NK cells.International Journal of Cancer. 120(6):1364-71.
  • info info
    添加购物车成功! 添加购物车失败!