CCL6 cDNA ORF Clone, Mouse, C-HA tag

Cat: MG50026-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CCL6 Reagents
CRO Services
Product recommended

All CCL6 Reagents
CCL6 cDNA ORF Clone, Mouse, C-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
351 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse chemokine (C-C motif) ligand 6 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Restriction Sites
KpnI + XbaI (6kb + 0.39kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
CCL6 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CCL6 cDNA ORF Clone, Mouse, C-HA tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5612
CCL6 cDNA ORF Clone, Mouse, C-HA tag Alternative Names
c10 cDNA ORF Clone, Mouse;MRP-1 cDNA ORF Clone, Mouse;RP23-320E6.4 cDNA ORF Clone, Mouse;Scya6 cDNA ORF Clone, Mouse
CCL6 Background Information

Chemokine (C-C motif) ligand 6 (CCL6), also known as C-C chemokine C10 has only been identified in rodents, which is a small cytokine belonging to the CC chemokine family, beta-chemokine subfamily. C-C chemokine C10 is involved in the chronic stages of host defense reactions. C10 chemokine rapidly promotes disease resolution in the cecal ligation and puncture (CLP) model through its direct effects on the cellular events critically involved in host defense during septic peritonitis. CCL6 appears to contribute to the macrophage infiltration that is independent of other CC chemokines. C10 is a prominent chemokine expressed in the central nervous system in experimental inflammatory demyelinating disease, also acts as a potent chemotactic factor for the migration of these leukocytes to the brain. CCL6 may be a mediator released by microglia for cell-cell communication under physiological as well as pathological conditions of CNS. Additionally, the chemokine CCL6 may alter tumor behavior by relieving its growth factor dependency and by promoting invasiveness as a result of local tissue apoptosis.

Full Name
chemokine (C-C motif) ligand 6
References
  • Asensio VC, et al. (1999) C10 is a novel chemokine expressed in experimental inflammatory demyelinating disorders that promotes recruitment of macrophages to the central nervous system. Am J Pathol. 154(4): 1181-91.
  • Steinhauser ML, et al. (2000) Chemokine C10 promotes disease resolution and survival in an experimental model of bacterial sepsis. Infect Immun. 68(11): 6108-14.
  • Yi F, et al. (2003) The CCL6 chemokine is differentially regulated by c-Myc and L-Myc, and promotes tumorigenesis and metastasis. Cancer Res. 63(11): 2923-32.
  • LaFleur AM, et al. (2004) Role of CC chemokine CCL6/C10 as a monocyte chemoattractant in a murine acute peritonitis. Mediators Inflamm. 13(5-6): 349-55.
  • Kanno M, et al. (2005) Functional expression of CCL6 by rat microglia: a possible role of CCL6 in cell-cell communication. J Neuroimmunol. 167(1-2): 72-80.
  •  

    CCL6/C10 related areas, pathways, and other information

    CCL6 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CCL6 cDNA ORF Clone in Cloning Vector, Rat RG80721-U
    CCL6 cDNA ORF Clone, Rat, untagged RG80721-UT
    CCL6 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80721-ACGLN
    CCL6 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80721-ACG
    CCL6 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80721-ACR
    CCL6 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80721-CF
    CCL6 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80721-NF
    CCL6 cDNA ORF Clone, Rat, C-His tag RG80721-CH
    CCL6 cDNA ORF Clone, Rat, N-His tag RG80721-NH
    CCL6 cDNA ORF Clone, Rat, C-HA tag RG80721-CY
    CCL6 cDNA ORF Clone, Rat, N-HA tag RG80721-NY
    CCL6 cDNA ORF Clone, Rat, C-Myc tag RG80721-CM
    CCL6 cDNA ORF Clone, Rat, N-Myc tag RG80721-NM
    CCL6 qPCR Primer Pairs, Rat RP300685

    CCL6 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CCL6 cDNA ORF Clone in Cloning Vector, Mouse MG50026-M
    CCL6 cDNA ORF Clone, Mouse, untagged MG50026-UT
    CCL6 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50026-ACGLN
    CCL6 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50026-ACG
    CCL6 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50026-ACR
    CCL6 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50026-CF
    CCL6 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50026-NF
    CCL6 cDNA ORF Clone, Mouse, C-His tag MG50026-CH
    CCL6 cDNA ORF Clone, Mouse, N-His tag MG50026-NH
    CCL6 cDNA ORF Clone, Mouse, N-HA tag MG50026-NY
    CCL6 cDNA ORF Clone, Mouse, C-Myc tag MG50026-CM
    CCL6 cDNA ORF Clone, Mouse, N-Myc tag MG50026-NM
    CCL6 qPCR Primer Pairs, Mouse MP200026
    info info
    添加购物车成功! 添加购物车失败!