Quick Order

Text Size:AAA

Mouse CCL21C natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Mouse CCL21C cDNA Clone Product Information
NCBI RefSeq:NM_023052.2
RefSeq ORF Size:402bp
cDNA Description:Full length Clone DNA of Mus musculus chemokine (C-C motif) ligand 21C (leucine).
Gene Synonym:SLC, CKb9, TCA4, Ccl21a, Scya21c, exodus-2, Ccl21c
Species:Mouse
Vector:pCMV3-untagged
Plasmid:pCMV3-mCCL21
Restriction Site:KpnI + XbaI (6.1kb + 0.4kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for two point mutations: 194 T/C resulting in the amino acid Leu substitution by ser and 84 A/T not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Mouse CCL21C Gene Plasmid Map
Mouse CCL21C Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Size / Price
Catalog: MG50341-UT
List Price:   (Save )
Price:      [How to order]
Availability
 Shipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"