CCDC80 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG50907-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CCDC80 Reagents
CRO Services
Product recommended

All CCDC80 Reagents
CCDC80 cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2850 bp
Description
Full length Clone DNA of Mouse coiled-coil domain containing 80 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CCDC80 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
2610001E17Rik cDNA ORF Clone, Mouse;DRO1 cDNA ORF Clone, Mouse;Ssg1 cDNA ORF Clone, Mouse;Urb cDNA ORF Clone, Mouse
CCDC80 Background Information
Full Name
coiled-coil domain containing 80

CCDC80 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CCDC80 cDNA ORF Clone in Cloning Vector, Rat RG84388-U
CCDC80 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG84388-ACGLN

CCDC80 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CCDC80 cDNA ORF Clone in Cloning Vector, Mouse MG50907-G
CCDC80 cDNA ORF Clone, Mouse, untagged MG50907-UT
CCDC80 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50907-ACGLN
CCDC80 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50907-ACG
CCDC80 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50907-ACR
CCDC80 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50907-CF
CCDC80 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50907-NF
CCDC80 cDNA ORF Clone, Mouse, C-His tag MG50907-CH
CCDC80 cDNA ORF Clone, Mouse, N-His tag MG50907-NH
CCDC80 cDNA ORF Clone, Mouse, C-HA tag MG50907-CY
CCDC80 cDNA ORF Clone, Mouse, N-HA tag MG50907-NY
CCDC80 cDNA ORF Clone, Mouse, C-Myc tag MG50907-CM
CCDC80 qPCR Primer Pairs, Mouse MP200878

CCDC80 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CCDC80 cDNA ORF Clone in Cloning Vector, Human HG10861-M
CCDC80 cDNA ORF Clone, Human, untagged HG10861-UT
CCDC80 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10861-ACGLN
CCDC80 cDNA ORF Clone, Human, C-GFPSpark® tag HG10861-ACG
CCDC80 cDNA ORF Clone, Human, C-OFPSpark® tag HG10861-ACR
CCDC80 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10861-CF
CCDC80 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10861-NF
CCDC80 cDNA ORF Clone, Human, C-His tag HG10861-CH
CCDC80 cDNA ORF Clone, Human, N-His tag HG10861-NH
CCDC80 cDNA ORF Clone, Human, C-HA tag HG10861-CY
CCDC80 cDNA ORF Clone, Human, N-HA tag HG10861-NY
CCDC80 cDNA ORF Clone, Human, C-Myc tag HG10861-CM
CCDC80 cDNA ORF Clone, Human, N-Myc tag HG10861-NM
CCDC80 qPCR Primer Pairs, Human HP100926
info info
添加购物车成功! 添加购物车失败!