CCDC115 cDNA ORF Clone, Mouse, untagged

Cat: MG52538-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CCDC115 Reagents
CRO Services
Product recommended

All CCDC115 Reagents
CCDC115 cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
543 bp
Description
Full length Clone DNA of Mouse coiled-coil domain containing 115.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CCDC115 cDNA ORF Clone, Mouse, untagged Alternative Names
2310061I09Rik cDNA ORF Clone, Mouse;Ccp1 cDNA ORF Clone, Mouse
CCDC115 Background Information
Full Name
coiled-coil domain containing 115

CCDC115 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CCDC115 cDNA ORF Clone in Cloning Vector, Mouse MG52538-G
CCDC115 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52538-ACGLN
CCDC115 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52538-ACG
CCDC115 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52538-ANG
CCDC115 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52538-ACR
CCDC115 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52538-ANR
CCDC115 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52538-CF
CCDC115 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52538-NF
CCDC115 cDNA ORF Clone, Mouse, C-His tag MG52538-CH
CCDC115 cDNA ORF Clone, Mouse, N-His tag MG52538-NH
CCDC115 cDNA ORF Clone, Mouse, C-HA tag MG52538-CY
CCDC115 cDNA ORF Clone, Mouse, N-HA tag MG52538-NY
CCDC115 cDNA ORF Clone, Mouse, C-Myc tag MG52538-CM
CCDC115 cDNA ORF Clone, Mouse, N-Myc tag MG52538-NM
CCDC115 qPCR Primer Pairs, Mouse MP202411

CCDC115 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CCDC115 cDNA ORF Clone in Cloning Vector, Human HG25221-U
CCDC115 cDNA ORF Clone, Human, untagged HG25221-UT
CCDC115 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG25221-ACGLN
CCDC115 cDNA ORF Clone, Human, C-GFPSpark® tag HG25221-ACG
CCDC115 cDNA ORF Clone, Human, N-GFPSpark® tag HG25221-ANG
CCDC115 cDNA ORF Clone, Human, C-OFPSpark® tag HG25221-ACR
CCDC115 cDNA ORF Clone, Human, N-OFPSpark® tag HG25221-ANR
CCDC115 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG25221-CF
CCDC115 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG25221-NF
CCDC115 cDNA ORF Clone, Human, C-His tag HG25221-CH
CCDC115 cDNA ORF Clone, Human, N-His tag HG25221-NH
CCDC115 cDNA ORF Clone, Human, C-HA tag HG25221-CY
CCDC115 cDNA ORF Clone, Human, N-HA tag HG25221-NY
CCDC115 cDNA ORF Clone, Human, C-Myc tag HG25221-CM
CCDC115 cDNA ORF Clone, Human, N-Myc tag HG25221-NM
info info
添加购物车成功! 添加购物车失败!