CBFB cDNA ORF Clone, Mouse, N-HA tag

Cat: MG52175-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CBFB Reagents
CRO Services
Product recommended

All CBFB Reagents
CBFB cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
549 bp
Description
Full length Clone DNA of Mouse core binding factor beta with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CBFB cDNA ORF Clone, Mouse, N-HA tag Alternative Names
AI893578 cDNA ORF Clone, Mouse;PEA2 cDNA ORF Clone, Mouse;Pebp2 cDNA ORF Clone, Mouse;PEBP2b cDNA ORF Clone, Mouse;Pebpb2 cDNA ORF Clone, Mouse
CBFB Background Information

CBFB is the beta subunit of a heterodimeric core-binding transcription factor belonging to the PEBP2/CBF transcription factor family which master-regulates a host of genes specific to hematopoiesis (e.g., RUNX1) and osteogenesis (e.g., RUNX2). CBFB is a non-DNA binding regulatory subunit; it allosterically enhances DNA binding by alpha subunit as the complex binds to the core site of various enhancers and promoters, including murine leukemia virus, polyomavirus enhancer, T-cell receptor enhancers and GM-CSF promoters. Alternative splicing generates two mRNA variants, each encoding a distinct carboxyl terminus. In some cases, a pericentric inversion of chromosome 16 [inv(16)(p13q22)] produces a chimeric transcript consisting of the N terminus of core-binding factor beta in a fusion with the C-terminal portion of the smooth muscle myosin heavy chain 11. This chromosomal rearrangement is associated with acute myeloid leukemia of the M4Eo subtype. Two transcript variants encoding different isoforms have been found for CBFB gene.  Mutations in CBFB are implicated in cases of breast cancer.

Full Name
core-binding factor, beta subunit
References
  • Hart SM. et al., 2003, Haematologica. 87(12): 1307-23.
  • Liu P. et al., 1995, Cold Spring Harb Symp Quant Biol. 59: 547-53.
  • Liu P. et al., 1993, Science. 261 (5124): 1041-4.
  • info info
    添加购物车成功! 添加购物车失败!