Quick Order

Mouse CBFB / CBF-beta Gene ORF cDNA clone expression plasmid, N-HA tag

DatasheetReviewsRelated ProductsProtocols
Mouse CBFB cDNA Clone Product Information
NCBI RefSeq:NM_001161458.1
RefSeq ORF Size:549bp
cDNA Description:Full length Clone DNA of Mus musculus core binding factor beta with N terminal HA tag.
Gene Synonym:PEA2; Pebp2; PEBP2b; Pebpb2; AI893578
Species:Mouse
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

CBFB is the beta subunit of a heterodimeric core-binding transcription factor belonging to the PEBP2/CBF transcription factor family which master-regulates a host of genes specific to hematopoiesis (e.g., RUNX1) and osteogenesis (e.g., RUNX2). CBFB is a non-DNA binding regulatory subunit; it allosterically enhances DNA binding by alpha subunit as the complex binds to the core site of various enhancers and promoters, including murine leukemia virus, polyomavirus enhancer, T-cell receptor enhancers and GM-CSF promoters. Alternative splicing generates two mRNA variants, each encoding a distinct carboxyl terminus. In some cases, a pericentric inversion of chromosome 16 [inv(16)(p13q22)] produces a chimeric transcript consisting of the N terminus of core-binding factor beta in a fusion with the C-terminal portion of the smooth muscle myosin heavy chain 11. This chromosomal rearrangement is associated with acute myeloid leukemia of the M4Eo subtype. Two transcript variants encoding different isoforms have been found for CBFB gene.  Mutations in CBFB are implicated in cases of breast cancer.

References
  • Hart SM. et al., 2003, Haematologica. 87(12): 1307-23.
  • Liu P. et al., 1995, Cold Spring Harb Symp Quant Biol. 59: 547-53.
  • Liu P. et al., 1993, Science. 261 (5124): 1041-4.
  • Size / Price
    Catalog: MG52175-NY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"