Carbonic Anhydrase IX cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG50660-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Carbonic Anhydrase IX Reagents
CRO Services
Product recommended

All Carbonic Anhydrase IX Reagents
Carbonic Anhydrase IX cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1314 bp
Description
Full length Clone DNA of Mouse carbonic anhydrase IX with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Carbonic Anhydrase IX Background Information

Carbonic anhydrases IX (CA IX), also known as membrane antigen MN or CA9, is a member of the carbonic anhydrase (CA) family and may be involved in cell proliferation and cellular transformation. CAs are zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide (H2O + CO2 = H+ + HCO3–) and thus participate in a variety of biological and physical processes. CA IX protein is expressed primarily in carcinoma cells lines, and the expression is cell density dependent and has been shown to be strongly induced by hypoxia, accordingly facilitates adaptation of tumor cells to hypoxic conditions. It is involved in tumorigenesis through many pathways, such as pH regulation and cell adhesion control. CA IX is used as a marker of tumor hypoxia and as a new therapeutic target for many human carcinomas and cancers.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
carbonic anhydrase IX
References
  • Loncaster JA, et al. (2001) Carbonic anhydrase (CA IX) expression, a potential new intrinsic marker of hypoxia: correlations with tumor oxygen measurements and prognosis in locally advanced carcinoma of the cervix. Cancer Res. 61(17): 6394-9.
  • Zvada J, et al. (2003) Soluble form of carbonic anhydrase IX (CA IX) in the serum and urine of renal carcinoma patients. Br J Cancer. 89(6): 1067-71.
  • Pan P, et al. (2006) Carbonic anhydrase gene expression in CA II-deficient (Car2-/-) and CA IX-deficient (Car9-/-) mice. J Physiol. 571(Pt 2): 319-27.
  • Zhou GX, et al. (2010) Quantification of carbonic anhydrase IX expression in serum and tissue of renal cell carcinoma patients using enzyme-linked immunosorbent assay: prognostic and diagnostic potentials. Urology. 75(2): 257-61.
  • Carbonic Anhydrase IX cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    Carbonic Anhydrase IX cDNA ORF Clone in Cloning Vector, Canine DG70002-G
    Carbonic Anhydrase IX cDNA ORF Clone, Canine, untagged DG70002-UT
    Carbonic Anhydrase IX cDNA ORF Clone, Canine, C-GFPSpark® tag DG70002-ACG
    Carbonic Anhydrase IX Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70002-ACGLN
    Carbonic Anhydrase IX cDNA ORF Clone, Canine, C-OFPSpark® tag DG70002-ACR
    Carbonic Anhydrase IX cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70002-CF
    Carbonic Anhydrase IX cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70002-NF
    Carbonic Anhydrase IX cDNA ORF Clone, Canine, C-His tag DG70002-CH
    Carbonic Anhydrase IX cDNA ORF Clone, Canine, N-His tag DG70002-NH
    Carbonic Anhydrase IX cDNA ORF Clone, Canine, C-HA tag DG70002-CY
    Carbonic Anhydrase IX cDNA ORF Clone, Canine, N-HA tag DG70002-NY
    Carbonic Anhydrase IX cDNA ORF Clone, Canine, C-Myc tag DG70002-CM
    Carbonic Anhydrase IX cDNA ORF Clone, Canine, N-Myc tag DG70002-NM

    Carbonic Anhydrase IX cDNA ORF Clone, Cynomolgus, Related Products

    Product Name Catalog#(PDF)
    Carbonic Anhydrase IX cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90894-CF

    Carbonic Anhydrase IX cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Carbonic Anhydrase IX cDNA ORF Clone in Cloning Vector, Mouse MG50660-G
    Carbonic Anhydrase IX cDNA ORF Clone, Mouse, untagged MG50660-UT
    Carbonic Anhydrase IX cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50660-ACG
    Carbonic Anhydrase IX Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50660-ACGLN
    Carbonic Anhydrase IX cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50660-ACR
    Carbonic Anhydrase IX cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50660-CF
    Carbonic Anhydrase IX cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50660-NF
    Carbonic Anhydrase IX cDNA ORF Clone, Mouse, C-His tag MG50660-CH
    Carbonic Anhydrase IX cDNA ORF Clone, Mouse, N-His tag MG50660-NH
    Carbonic Anhydrase IX cDNA ORF Clone, Mouse, C-HA tag MG50660-CY
    Carbonic Anhydrase IX cDNA ORF Clone, Mouse, N-HA tag MG50660-NY
    Carbonic Anhydrase IX cDNA ORF Clone, Mouse, N-Myc tag MG50660-NM
    Carbonic Anhydrase IX qPCR Primer Pairs, Mouse MP200639

    Carbonic Anhydrase IX cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Carbonic Anhydrase IX cDNA ORF Clone in Cloning Vector, Human HG10107-M
    Carbonic Anhydrase IX cDNA ORF Clone, Human, untagged HG10107-UT
    Carbonic Anhydrase IX Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10107-ACGLN
    Carbonic Anhydrase IX cDNA ORF Clone, Human, C-GFPSpark® tag HG10107-ACG
    Carbonic Anhydrase IX cDNA ORF Clone, Human, N-GFPSpark® tag HG10107-ANG
    Carbonic Anhydrase IX cDNA ORF Clone, Human, C-OFPSpark® tag HG10107-ACR
    Carbonic Anhydrase IX cDNA ORF Clone, Human, N-OFPSpark® tag HG10107-ANR
    Carbonic Anhydrase IX cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10107-CF
    Carbonic Anhydrase IX cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10107-NF
    Carbonic Anhydrase IX cDNA ORF Clone, Human, C-His tag HG10107-CH
    Carbonic Anhydrase IX cDNA ORF Clone, Human, N-His tag HG10107-NH
    Carbonic Anhydrase IX cDNA ORF Clone, Human, C-HA tag HG10107-CY
    Carbonic Anhydrase IX cDNA ORF Clone, Human, N-HA tag HG10107-NY
    Carbonic Anhydrase IX cDNA ORF Clone, Human, C-Myc tag HG10107-CM
    Carbonic Anhydrase IX cDNA ORF Clone, Human, N-Myc tag HG10107-NM
    Carbonic Anhydrase IX qPCR Primer Pairs, Human HP100028
    info info
    添加购物车成功! 添加购物车失败!