CA8 cDNA ORF Clone, Mouse, N-His tag

Cat: MG50767-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CA8 Reagents
CRO Services
Product recommended

All CA8 Reagents
CA8 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
876 bp
Description
Full length Clone DNA of Mouse carbonic anhydrase 8 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CA8 cDNA ORF Clone, Mouse, N-His tag Alternative Names
AW546993 cDNA ORF Clone, Mouse;Ca8 cDNA ORF Clone, Mouse;Cals cDNA ORF Clone, Mouse;Cals1 cDNA ORF Clone, Mouse;Car8 cDNA ORF Clone, Mouse;Carp cDNA ORF Clone, Mouse;RP23-180H12.1 cDNA ORF Clone, Mouse;wdl cDNA ORF Clone, Mouse
CA8 Background Information

The carbonic anhydrases (or carbonate dehydratases) are classified as metalloenzyme for its zinc ion prosthetic group and form a family of enzymes that catalyze the rapid interconversion of carbon dioxide and water to bicarbonate and protons, a reversible reaction that takes part in maintaining acid-base balance in blood and other tissues. The carbonic anhydrasekl (CA) family consists of at least 11 enzymatically active members and a few inactive homologous proteins. Carbonic anhydrase protein (CA) VIII, which is a member of the CA gene family, has been shown to have no catalytic CA activity and its biological function is still unknown. Increased expression of CA-RP VIII was observed in 78% of colorectal carcinomas. It suggested that CA-RP VIII plays a role in the process of invasion in colorectal cancer.

Full Name
carbonic anhydrase VIII
References
  • Lehtonen J, et al. (2004) Characterization of CA XIII, a Novel Member of the Carbonic Anhydrase Isozyme Family. The Journal of Biological Chemistry. 279: 2719-27.
  • Lindskog S. (1997) Structure and mechanism of carbonic anhydrase. Pharmacology & Therapeutics. 74(1):1-20.
  • Miyaji E, et al. (2003) Overexpression of carbonic anhydrase-related protein VIII in human colorectal cancer. The Journal of Pathology. 201(1): 37-45.
  • CA8 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CA8 cDNA ORF Clone in Cloning Vector, Mouse MG50767-G
    CA8 cDNA ORF Clone, Mouse, untagged MG50767-UT
    CA8 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50767-ACG
    CA8 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50767-ACGLN
    CA8 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50767-ANG
    CA8 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50767-ACR
    CA8 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50767-ANR
    CA8 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50767-CF
    CA8 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50767-NF
    CA8 cDNA ORF Clone, Mouse, C-His tag MG50767-CH
    CA8 cDNA ORF Clone, Mouse, C-HA tag MG50767-CY
    CA8 cDNA ORF Clone, Mouse, N-HA tag MG50767-NY
    CA8 cDNA ORF Clone, Mouse, C-Myc tag MG50767-CM
    CA8 cDNA ORF Clone, Mouse, N-Myc tag MG50767-NM
    CA8 qPCR Primer Pairs, Mouse MP200741

    CA8 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CA8 cDNA ORF Clone in Cloning Vector, Human HG10063-M
    CA8 cDNA ORF Clone, Human, untagged HG10063-UT
    CA8 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10063-ACGLN
    CA8 cDNA ORF Clone, Human, C-GFPSpark® tag HG10063-ACG
    CA8 cDNA ORF Clone, Human, N-GFPSpark® tag HG10063-ANG
    CA8 cDNA ORF Clone, Human, C-OFPSpark® tag HG10063-ACR
    CA8 cDNA ORF Clone, Human, N-OFPSpark® tag HG10063-ANR
    CA8 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10063-CF
    CA8 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10063-NF
    CA8 cDNA ORF Clone, Human, C-His tag HG10063-CH
    CA8 cDNA ORF Clone, Human, N-His tag HG10063-NH
    CA8 cDNA ORF Clone, Human, C-HA tag HG10063-CY
    CA8 cDNA ORF Clone, Human, N-HA tag HG10063-NY
    CA8 cDNA ORF Clone, Human, C-Myc tag HG10063-CM
    CA8 cDNA ORF Clone, Human, N-Myc tag HG10063-NM
    CA8 qPCR Primer Pairs, Human HP100150
    info info
    添加购物车成功! 添加购物车失败!