Carbonic Anhydrase X cDNA ORF Clone, Mouse, N-His tag

Cat: MG50768-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Carbonic Anhydrase X Reagents
CRO Services
Product recommended

All Carbonic Anhydrase X Reagents
Carbonic Anhydrase X cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
987 bp
Description
Full length Clone DNA of Mouse carbonic anhydrase 10 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Carbonic Anhydrase X cDNA ORF Clone, Mouse, N-His tag Alternative Names
2700029L05Rik cDNA ORF Clone, Mouse;BB085816 cDNA ORF Clone, Mouse;Ca10 cDNA ORF Clone, Mouse;Car10 cDNA ORF Clone, Mouse;RP23-448I9.1 cDNA ORF Clone, Mouse
Carbonic Anhydrase X Background Information

Carbonic anhydrase X, also called carbonic anhydrase - related protein X (CARPX) and CA10, belongs to the CA family of zinc metalloenzymes which catalyze the reversible hydration of carbon dioxide in various biological processes such as respiration, renal tubular acidification and bone resorption. The secreted protein CARPX without CA activity (hydration of CO2) is identified as an acatalytic member of the alpha-carbonic anhydrase subgroup. CARP X expression is detected in the adult total brain and almost all parts of the central nervous system, but not in the fetal brain. Accordingly, CARP X is suggested to play a role in the development of central nervous system, especially the brain. The same CARP X protein are encoded by multiple transcript variants of this gene.

Full Name
carbonic anhydrase X
References
  • Okamoto, N. et al., 2001, Biochim. Biophys. Acta 1518:311-316.
  • Taniuchi, K. et al., Neuroscience 112: 93-99.
  • Supuran, C.T. et al., 2003, Med. Res. Rev. 23: 146-189.
  • Carbonic Anhydrase X cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    Carbonic Anhydrase X cDNA ORF Clone in Cloning Vector, Rhesus CG90489-G
    Carbonic Anhydrase X cDNA ORF Clone, Rhesus, untagged CG90489-UT
    Carbonic Anhydrase X Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90489-ACGLN
    Carbonic Anhydrase X cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90489-ACG
    Carbonic Anhydrase X cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90489-ANG
    Carbonic Anhydrase X cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90489-ACR
    Carbonic Anhydrase X cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90489-ANR
    Carbonic Anhydrase X cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90489-CF
    Carbonic Anhydrase X cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90489-NF
    Carbonic Anhydrase X cDNA ORF Clone, Rhesus, C-His tag CG90489-CH
    Carbonic Anhydrase X cDNA ORF Clone, Rhesus, N-His tag CG90489-NH
    Carbonic Anhydrase X cDNA ORF Clone, Rhesus, C-HA tag CG90489-CY
    Carbonic Anhydrase X cDNA ORF Clone, Rhesus, N-HA tag CG90489-NY
    Carbonic Anhydrase X cDNA ORF Clone, Rhesus, C-Myc tag CG90489-CM
    Carbonic Anhydrase X cDNA ORF Clone, Rhesus, N-Myc tag CG90489-NM

    Carbonic Anhydrase X cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Carbonic Anhydrase X cDNA ORF Clone in Cloning Vector, Mouse MG50768-G
    Carbonic Anhydrase X cDNA ORF Clone, Mouse, untagged MG50768-UT
    Carbonic Anhydrase X cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50768-ACG
    Carbonic Anhydrase X Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50768-ACGLN
    Carbonic Anhydrase X cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50768-ANG
    Carbonic Anhydrase X cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50768-ACR
    Carbonic Anhydrase X cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50768-ANR
    Carbonic Anhydrase X cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50768-CF
    Carbonic Anhydrase X cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50768-NF
    Carbonic Anhydrase X cDNA ORF Clone, Mouse, C-His tag MG50768-CH
    Carbonic Anhydrase X cDNA ORF Clone, Mouse, C-HA tag MG50768-CY
    Carbonic Anhydrase X cDNA ORF Clone, Mouse, N-HA tag MG50768-NY
    Carbonic Anhydrase X cDNA ORF Clone, Mouse, C-Myc tag MG50768-CM
    Carbonic Anhydrase X cDNA ORF Clone, Mouse, N-Myc tag MG50768-NM
    Carbonic Anhydrase X qPCR Primer Pairs, Mouse MP200742

    Carbonic Anhydrase X cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Carbonic Anhydrase X qPCR Primer Pairs, Human HP100879
    info info
    添加购物车成功! 添加购物车失败!