CAPZB cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG51824-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CAPZB Reagents
CRO Services
Product recommended

All CAPZB Reagents
CAPZB cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
819 bp
Description
Full length Clone DNA of Mouse capping protein (actin filament) muscle Z-line, beta with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CAPZB cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
1700120C01Rik cDNA ORF Clone, Mouse;AI325129 cDNA ORF Clone, Mouse;Cappb1 cDNA ORF Clone, Mouse;CPB1 cDNA ORF Clone, Mouse;CPB2 cDNA ORF Clone, Mouse;CPbeat2 cDNA ORF Clone, Mouse;CPbeta1 cDNA ORF Clone, Mouse;CPbeta2 cDNA ORF Clone, Mouse
CAPZB Background Information
Full Name
capping protein (actin filament) muscle Z-line, beta

CAPZB cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CAPZB cDNA ORF Clone in Cloning Vector, Mouse MG51824-G
CAPZB cDNA ORF Clone, Mouse, untagged MG51824-UT
CAPZB Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51824-ACGLN
CAPZB cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51824-ACG
CAPZB cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51824-ANG
CAPZB cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51824-ACR
CAPZB cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51824-ANR
CAPZB cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51824-CF
CAPZB cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51824-NF
CAPZB cDNA ORF Clone, Mouse, C-His tag MG51824-CH
CAPZB cDNA ORF Clone, Mouse, N-His tag MG51824-NH
CAPZB cDNA ORF Clone, Mouse, C-HA tag MG51824-CY
CAPZB cDNA ORF Clone, Mouse, N-HA tag MG51824-NY
CAPZB cDNA ORF Clone, Mouse, N-Myc tag MG51824-NM
CAPZB qPCR Primer Pairs, Mouse MP201697

CAPZB cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CAPZB cDNA ORF Clone in Cloning Vector, Human HG11627-M
CAPZB cDNA ORF Clone, Human, untagged HG11627-UT
CAPZB cDNA ORF Clone, Human, C-GFPSpark® tag HG11627-ACG
CAPZB Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11627-ACGLN
CAPZB cDNA ORF Clone, Human, N-GFPSpark® tag HG11627-ANG
CAPZB cDNA ORF Clone, Human, C-OFPSpark® tag HG11627-ACR
CAPZB cDNA ORF Clone, Human, N-OFPSpark® tag HG11627-ANR
CAPZB cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11627-CF
CAPZB cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11627-NF
CAPZB cDNA ORF Clone, Human, C-His tag HG11627-CH
CAPZB cDNA ORF Clone, Human, N-His tag HG11627-NH
CAPZB cDNA ORF Clone, Human, C-HA tag HG11627-CY
CAPZB cDNA ORF Clone, Human, N-HA tag HG11627-NY
CAPZB cDNA ORF Clone, Human, C-Myc tag HG11627-CM
CAPZB cDNA ORF Clone, Human, N-Myc tag HG11627-NM
CAPZB qPCR Primer Pairs, Human HP101480
info info
添加购物车成功! 添加购物车失败!