Quick Order

Mouse CAMKV Gene ORF cDNA clone expression plasmid, N-HA tag

DatasheetReviewsRelated ProductsProtocols
Mouse CAMKV cDNA Clone Product Information
NCBI RefSeq:NM_145621.2
RefSeq ORF Size:1539bp
cDNA Description:Full length Clone DNA of Mus musculus CaM kinase-like vesicle-associated with N terminal HA tag.
Gene Synonym:1G5, BB074618, BC017634
Species:Mouse
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

CaM kinase-like vesicle-associated protein, also known as CAMKV, is a peripheral membrane protein and Cytoplasmic vesicle membrane protein which belongs to the protein kinase superfamily and CAMK Ser/Thr protein kinase family. CAMKV contains one protein kinase domain. It is predominantly observed in association with the plasma membrane of soma and in neurites, both axons and dendrites. CAMKV may be associated with vesicular structures. It does not appear to have detectable kinase activity.

Protein kinases are a group of enzymes that move a phosphate group onto proteins, in a process called phosphorylation. Protein kinases function as an on/off switch for many cellular processes, including metabolism, transcription, cell cycle progression, cytoskeletal rearrangement and cell movement, apoptosis, and differentiation. They also function in embryonic development, physiological responses, and in the nervous and immune system. Abnormal phosphorylation causes many human diseases, including cancer, and drugs that affect phosphorylation can treat those diseases. The protein kinase domain is a structurally conserved protein domain containing the catalytic function of protein kinases. Protein kinases play a role in a mulititude of cellular processes, including division, proliferation, apoptosis, and differentiation. Phosphorylation usually results in a functional change of the target protein by changing enzyme activity, cellular location, or association with other proteins.

References
  • Hunter T, et al.,1988, Science. 241 (4861): 42-51.
  • Wiemann S., et al., 2001, Genome Res. 11:422-435.
  • G. Manning, et al., 2002, Science 6. 298:1912-1934.
  • Manning G, et al.,2002, Science. 298 (5600): 1912-34.
  • Ota T., et al., 2004, Nat. Genet. 36:40-45.
  • Size / Price
    Catalog: MG52245-NY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"