Quick Order

Text Size:AAA

Mouse CAMKV Gene ORF cDNA clone expression plasmid, C-Flag tag

DatasheetReviewsRelated ProductsProtocols
Mouse CAMKV cDNA Clone Product Information
NCBI RefSeq:NM_145621.2
RefSeq ORF Size:1539bp
cDNA Description:Full length Clone DNA of Mus musculus CaM kinase-like vesicle-associated with C terminal Flag tag.
Gene Synonym:1G5, BB074618, BC017634
Species:Mouse
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

CaM kinase-like vesicle-associated protein, also known as CAMKV, is a peripheral membrane protein and Cytoplasmic vesicle membrane protein which belongs to the protein kinase superfamily and CAMK Ser/Thr protein kinase family. CAMKV contains one protein kinase domain. It is predominantly observed in association with the plasma membrane of soma and in neurites, both axons and dendrites. CAMKV may be associated with vesicular structures. It does not appear to have detectable kinase activity.

Protein kinases are a group of enzymes that move a phosphate group onto proteins, in a process called phosphorylation. Protein kinases function as an on/off switch for many cellular processes, including metabolism, transcription, cell cycle progression, cytoskeletal rearrangement and cell movement, apoptosis, and differentiation. They also function in embryonic development, physiological responses, and in the nervous and immune system. Abnormal phosphorylation causes many human diseases, including cancer, and drugs that affect phosphorylation can treat those diseases. The protein kinase domain is a structurally conserved protein domain containing the catalytic function of protein kinases. Protein kinases play a role in a mulititude of cellular processes, including division, proliferation, apoptosis, and differentiation. Phosphorylation usually results in a functional change of the target protein by changing enzyme activity, cellular location, or association with other proteins.

References
  • Hunter T, et al.,1988, Science. 241 (4861): 42-51.
  • Wiemann S., et al., 2001, Genome Res. 11:422-435.
  • G. Manning, et al., 2002, Science 6. 298:1912-1934.
  • Manning G, et al.,2002, Science. 298 (5600): 1912-34.
  • Ota T., et al., 2004, Nat. Genet. 36:40-45.
  • Size / Price
    Catalog: MG52245-CF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"