CAMKI cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG52781-CF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All CAMKI Reagents

CRO Services

Product recommended


All CAMKI Reagents

CAMKI cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1125 bp
Description
Full length Clone DNA of Mouse calcium/calmodulin-dependent protein kinase I with C terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CAMKI cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names

AI505105 cDNA ORF Clone, Mouse;CaMKIalpha cDNA ORF Clone, Mouse;D6Ertd263e cDNA ORF Clone, Mouse

CAMKI Background Information

Calcium/calmodulin-dependent protein kinase or CaM kinases are serine/threonine-specific protein kinases that are primarily regulated by the Calcium/calmodulin complex. These kinases show a memory effect on activation. CaM kinases activity can outlast the intracellular calcium transient that is needed to activate it. In neurons, this property is important for the induction of synaptic plasticity. Pharmacological inhibition of CaM kinases II blocks the induction of long-term potentiation. Upon activation, CaM kinases II phosphorylates postsynaptic glutamate receptors and changes the electrical properties of the synapse.

Calcium/calmodulin-dependent protein kinase type 1D, also known as CaM kinase I delta, CaM kinase ID, CaMKI-like protein kinase, CKLiK and CAMK1D, is a member of the protein kinase superfamily and CaMK subfamily. It contains one protein kinase domain. CAMK1D is broadly expressed. It is highly and mostly expressed in polymorphonuclear leukocytes (neutrophilic and eosinophilic granulocytes) while little or no expression is observed in monocytes and lymphocytes. Engineered overexpression of CAMK1D in non-tumorigenic breast epithelial cells led to increased cell proliferation, and molecular and phenotypic alterations indicative of epithelial-mesenchymal transition (EMT), including loss of cell-cell adhesions and increased cell migration and invasion. CAMK1D is a potential therapeutic target with particular relevance to clinically unfavorable basal-like tumors.

Full Name
calcium/calmodulin-dependent protein kinase I
References
  • Lisman, JE. et al., 1985, Proc Natl Acad Sci USA. 82 (9): 3055-7.
  • Bergamaschi, A. et al., 2008, Mol Oncol. 2 (4): 327-39.
  • White RB. et al., 2008, Physiological genomics, 33 (1): 41-9.
  • Schleinitz, D. et al., 2010, Horm Metab Res. 42 (1): 14-22.
  • info info
    添加购物车成功! 添加购物车失败!