CALM2 cDNA ORF Clone, Mouse, C-HA tag

Cat: MG51329-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CALM2 Reagents
CRO Services
Product recommended

All CALM2 Reagents
CALM2 cDNA ORF Clone, Mouse, C-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
450 bp
Description
Full length Clone DNA of Mouse calmodulin 2 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CALM2 cDNA ORF Clone, Mouse, C-HA tag Alternative Names
1500001E21Rik cDNA ORF Clone, Mouse;AL024017 cDNA ORF Clone, Mouse
CALM2 Background Information

Calmodulin 2, also known as CALM2, is a calmodulin. Calmodulin 2 mediates the control of a large number of enzymes, ion channels and other proteins by Ca(2+). It is involved in a genetic pathway that regulates the centrosome cycle and progression through cytokinesis. Calmodulin 2 gene may be a genetic determinant of hip osteoarthritis (OA). OA is a degenerative disease characterized by gradual loss of articular cartilage and is a leading cause of disability in elderly populations. CALM2 was most abundantly expressed in articular chondrocytes and OA cartilage.

Full Name
calmodulin 2 (phosphorylase kinase, delta)
References
  • Egli R, et al. (1993) Localization of the human bona fide calmodulin genes CALM1, CALM2, and CALM3 to chromosomes 14q24-q31, 2p21.1-p21.3, and 19q13.2-q13.3. Genomics. 16(2): 461-5.
  • Mikiko, et al. (2002) Centrosomal proteins CG-NAP and kendrin provide microtubule nucleation sites by anchoring gamma-tubulin ring complex. Mol Biol Cell. 13(9):3235-45.
  • SenGupta B, et al. (1987) Molecular analysis of human and rat calmodulin complementary DNA clones. Evidence for additional active genes in these species. J Biol Chem. 262(34): 16663-70.
  • CALM2 cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    CALM2 cDNA ORF Clone in Cloning Vector, Canine DG70131-U

    CALM2 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CALM2 cDNA ORF Clone in Cloning Vector, Rat RG82394-U
    CALM2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG82394-ACGLN

    CALM2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CALM2 cDNA ORF Clone in Cloning Vector, Mouse MG51329-U
    CALM2 cDNA ORF Clone, Mouse, untagged MG51329-UT
    CALM2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51329-ACG
    CALM2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51329-ACGLN
    CALM2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51329-ANG
    CALM2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51329-ACR
    CALM2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51329-ANR
    CALM2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51329-CF
    CALM2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51329-NF
    CALM2 cDNA ORF Clone, Mouse, C-His tag MG51329-CH
    CALM2 cDNA ORF Clone, Mouse, N-His tag MG51329-NH
    CALM2 cDNA ORF Clone, Mouse, N-HA tag MG51329-NY
    CALM2 cDNA ORF Clone, Mouse, C-Myc tag MG51329-CM
    CALM2 cDNA ORF Clone, Mouse, N-Myc tag MG51329-NM
    CALM2 qPCR Primer Pairs, Mouse MP201206

    CALM2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CALM2 cDNA ORF Clone in Cloning Vector, Human HG16230-G
    CALM2 cDNA ORF Clone, Human, untagged HG16230-UT
    CALM2 cDNA ORF Clone, Human, untagged HG12435-G-N
    CALM2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12435-ACGLN
    CALM2 cDNA ORF Clone, Human, C-GFPSpark® tag HG16230-ACG
    CALM2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16230-ACGLN
    CALM2 cDNA ORF Clone, Human, N-GFPSpark® tag HG16230-ANG
    CALM2 cDNA ORF Clone, Human, C-OFPSpark® tag HG16230-ACR
    CALM2 cDNA ORF Clone, Human, N-OFPSpark® tag HG16230-ANR
    CALM2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16230-CF
    CALM2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16230-NF
    CALM2 cDNA ORF Clone, Human, C-His tag HG16230-CH
    CALM2 cDNA ORF Clone, Human, N-His tag HG16230-NH
    CALM2 cDNA ORF Clone, Human, C-HA tag HG16230-CY
    CALM2 cDNA ORF Clone, Human, N-HA tag HG16230-NY
    CALM2 cDNA ORF Clone, Human, C-Myc tag HG16230-CM
    CALM2 cDNA ORF Clone, Human, N-Myc tag HG16230-NM
    CALM2 qPCR Primer Pairs, Human HP104779
    info info
    添加购物车成功! 添加购物车失败!