After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse CADM4/IGSF4C/NECL-4 Gene ORF cDNA clone expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Mouse CADM4 cDNA Clone Product Information
NCBI RefSeq:NM_153112.3
RefSeq ORF Size:1167bp
cDNA Description:Full length Clone DNA of Mus musculus cell adhesion molecule 4 with C terminal Myc tag.
Gene Synonym:Tsll2, Igdf4c, Igsf4c, Cadm4
Species:Mouse
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Immunoglobulin superfamily member 4C (IGSF4C), also known as CADM4 or NECL-4, is an immunoglobulin (Ig) superfamily molecule showing significant homology with a lung tumor suppressor, TSLC1. CADM4/IGSF4C/NECL-4 protein is mainly expressed in the kidney, bladder, and prostate in addition to the brain. Experiments have reported the biological significance of CADM4/IGSF4C/NECL-4 in the urinary tissues. An immunohistochemical study reveals that CADM4 is expressed at the cell-cell attachment sites in the renal tubules, the transitional epithelia of the bladder, and the glandular epithelia of the prostate. IGSF4-immunoreactivity (IR) was observed diffusely in the telencephalic wall, whereas it became rather confined to the subplate, the cortical plate and the subventricular zone as the development proceeded. IGSF4-IR gradually decreased after birth and disappeared in adulthood. IGSF4 remained at low levels throughout embryonic stage, whereas it increased after birth. These spatiotemporal patterns of the expression suggest that IGSF4 plays crucial roles in the development of both telencephalon and cerebellum. CADM4/IGSF4C/NECL-4 is ectopically expressed in adult T-cell leukemia (ATL) cells, providing not only a diagnostic marker for ATL, but also a possible therapeutic target against its invasion. The distinct roles of CADM4/IGSF4C/NECL-4 in the oncogenesis of carcinomas and ATL could be due to tissue-specific differences in the downstream cascades, and is a novel concept with respect to cell adhesion in human oncogenesis.

References
  • Williams YN, et al. (2006) Cell adhesion and prostate tumor-suppressor activity of TSLL2/IGSF4C, an immunoglobulin superfamily molecule homologous to TSLC1/IGSF4. Oncogene. 25(10): 1446-53.
  • Ohta Y, et al. (2005) Spatiotemporal patterns of expression of IGSF4 in developing mouse nervous system. Brain Res Dev Brain Res. 156(1): 23-31.
  • Shingai T, et al. (2003) Implications of nectin-like molecule-2 /IGSF4 /RA175 /SgIGSF /TSLC1 /SynCAM1 in cell-cell adhesion and transmembrane protein localization in epithelial cells. J Biol Chem. 278(37): 35421-7.
  • Size / Price
    Catalog: MG50501-CM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"